Mutagenetix > Incidental Mutation

Incidental Mutation 'R7215:Otoa'

568667

Institutional Source

Beutler Lab

Gene Symbol

Otoa

Ensembl Gene

ENSMUSG00000034990

Gene Name

otoancorin

Synonyms

MMRRC Submission

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R7215 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

121081650-121163097 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 121118572 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Valine to Alanine at position 19 (V19A)

Ref Sequence

ENSEMBL: ENSMUSP00000146799 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000047025] [ENSMUST00000163275]

AlphaFold

Q8K561

Predicted Effect

silent
Transcript: ENSMUST00000047025

SMART Domains

Protein: ENSMUSP00000044177
Gene: ENSMUSG00000034990

Domain	Start	End	E-Value	Type
signal peptide	1	23	N/A	INTRINSIC
low complexity region	896	908	N/A	INTRINSIC
low complexity region	1072	1089	N/A	INTRINSIC
low complexity region	1124	1133	N/A	INTRINSIC

Predicted Effect

unknown
Transcript: ENSMUST00000163275
AA Change: V19A

Predicted Effect

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.6%
20x: 98.8%

Validation Efficiency

98% (79/81)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is specifically expressed in the inner ear, and is located at the interface between the apical surface of the inner ear sensory epithelia and their overlying acellular gels. It is prposed that this protein is involved in the attachment of the inner ear acellular gels to the apical surface of the underlying nonsensory cells. Mutations in this gene are associated with autosomal recessive deafness type 22 (DFNB22). Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Sep 2009]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit hearing loss, detachment of the tectorial membrane from the spiral limbus, abnormal tectorial membrane morphology, absence of Hensen's stripe and increased cochlear nerve coumpond action potential threshold. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 82 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2210408I21Rik	G	A	13: 77,323,571	V1032M	possibly damaging	Het
Abca13	T	A	11: 9,288,405		probably null	Het
Adamts14	T	A	10: 61,211,596	H739L	possibly damaging	Het
Adgrl3	A	G	5: 81,693,550	E758G	probably damaging	Het
Ano3	T	A	2: 110,665,932	T826S	probably damaging	Het
Arhgap45	C	T	10: 80,025,482	T493I	possibly damaging	Het
Atg9b	A	C	5: 24,388,041	W455G	probably damaging	Het
Atp4a	A	G	7: 30,717,360	N496S	possibly damaging	Het
Bckdk	T	A	7: 127,905,110	D60E	possibly damaging	Het
Blmh	A	T	11: 76,965,899	K244*	probably null	Het
Btbd17	T	C	11: 114,791,465	I474V	possibly damaging	Het
C87436	A	G	6: 86,462,680	E451G	possibly damaging	Het
Camta1	T	C	4: 151,144,737	E546G	probably damaging	Het
Casp1	A	G	9: 5,298,523		probably null	Het
Ccdc114	C	T	7: 45,936,622	R148C	probably damaging	Het
Ccdc116	A	G	16: 17,139,928	Y456H	probably damaging	Het
Cep350	A	C	1: 155,894,707	S1812R	possibly damaging	Het
Chrna10	A	G	7: 102,112,208	L392P	possibly damaging	Het
Col22a1	A	T	15: 71,970,332	C434*	probably null	Het
Cxcl9	G	A	5: 92,323,888	Q98*	probably null	Het
Cyp2c54	G	A	19: 40,046,182	T348I	probably damaging	Het
Dnah7a	G	A	1: 53,618,350	R756C	probably damaging	Het
Dnajc18	T	C	18: 35,681,981	T239A	probably benign	Het
Dnase2a	A	T	8: 84,909,770		probably null	Het
Dpyd	A	G	3: 119,266,032	T793A	probably benign	Het
E430018J23Rik	A	G	7: 127,391,523	S431P	probably benign	Het
Edil3	T	C	13: 88,822,050		probably null	Het
Ehd1	T	A	19: 6,297,642	I342N	possibly damaging	Het
Erbb4	A	T	1: 68,339,460	S341T	probably benign	Het
Ezh1	T	A	11: 101,215,299	T87S	probably benign	Het
Fam20b	A	T	1: 156,690,553	W224R	probably damaging	Het
Galns	A	T	8: 122,599,348		probably null	Het
Gm13283	C	T	4: 88,760,730		probably benign	Het
Gm15448	C	T	7: 3,822,311	C444Y	unknown	Het
Gm49342	A	T	14: 50,944,583	M23L	probably benign	Het
Gm5114	T	A	7: 39,411,371	H18L	probably benign	Het
Gpr89	A	G	3: 96,880,088	W299R	probably damaging	Het
Hadha	G	T	5: 30,119,842	N755K	probably benign	Het
Inpp5d	A	T	1: 87,701,218	H620L	probably benign	Het
Klk1b3	T	A	7: 44,200,404		probably null	Het
Macf1	T	C	4: 123,507,304	T663A	probably damaging	Het
Man1b1	A	G	2: 25,350,390	N601S	probably benign	Het
Mbtps1	A	G	8: 119,524,568	V605A	possibly damaging	Het
Med23	C	G	10: 24,888,429	D311E	probably benign	Het
Myo3a	G	T	2: 22,245,567	D82Y	possibly damaging	Het
Nsd1	T	A	13: 55,247,641	D1121E	probably benign	Het
Olfr1042	C	T	2: 86,159,456	V305I	probably benign	Het
Olfr1221	G	A	2: 89,112,501	Q4*	probably null	Het
Olfr918	A	G	9: 38,673,447	I12T	probably benign	Het
Pcdhb20	A	T	18: 37,505,386	T322S	probably benign	Het
Pecam1	T	C	11: 106,695,919	T257A	probably benign	Het
Pi16	G	T	17: 29,319,098		probably benign	Het
Pik3c2g	C	T	6: 139,754,863	T293M		Het
Pkhd1l1	T	A	15: 44,528,163	C1542S	possibly damaging	Het
Prrc2b	G	A	2: 32,229,297	G2172R	probably damaging	Het
Prrt1	A	T	17: 34,629,703		probably null	Het
Ptprb	T	A	10: 116,338,776	N784K	possibly damaging	Het
Rem1	C	A	2: 152,628,149	S18R	probably damaging	Het
Ripk4	G	A	16: 97,747,323		probably null	Het
Scn8a	G	A	15: 101,029,830	V1397I	possibly damaging	Het
Setbp1	T	A	18: 78,856,837	H1205L	probably damaging	Het
Shmt1	T	C	11: 60,801,535	I132V	probably damaging	Het
Slc24a1	T	A	9: 64,928,503	T781S	unknown	Het
Sncaip	C	T	18: 52,907,343	Q870*	probably null	Het
Stab1	A	T	14: 31,160,797	N416K	possibly damaging	Het
Tcea1	A	G	1: 4,867,483	D26G	probably damaging	Het
Tcf20	A	T	15: 82,853,489	S1254T	probably benign	Het
Tead4	T	A	6: 128,228,678	I354F	probably damaging	Het
Tex36	G	A	7: 133,587,418	R142*	probably null	Het
Trav6d-3	T	A	14: 52,725,342	L12Q	probably damaging	Het
Trpc4	A	G	3: 54,194,896	T72A	possibly damaging	Het
Trrap	G	A	5: 144,797,135	A933T	probably benign	Het
Tspoap1	T	A	11: 87,770,489	I589N	probably benign	Het
Ttll5	T	A	12: 85,933,396	V918E	probably benign	Het
Txn2	A	G	15: 77,927,686		probably null	Het
Ucn3	T	G	13: 3,941,365	T96P	probably benign	Het
Usp36	T	C	11: 118,265,154	E764G	possibly damaging	Het
Vmn2r23	A	T	6: 123,704,364	H77L	probably benign	Het
Vmn2r57	T	C	7: 41,400,286	T680A	probably benign	Het
Vwa3a	T	C	7: 120,795,630	I891T	possibly damaging	Het
Zcchc11	T	C	4: 108,527,008	Y1091H	probably damaging	Het
Zhx2	A	G	15: 57,823,643	I803V	probably benign	Het

Other mutations in Otoa

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01469:Otoa	APN	7	121155273	critical splice donor site	probably null
IGL01791:Otoa	APN	7	121155849	missense	probably benign	0.25
IGL01924:Otoa	APN	7	121105968	missense	probably damaging	0.99
IGL01953:Otoa	APN	7	121160325	splice site	probably null
IGL02121:Otoa	APN	7	121122024	missense	probably benign	0.06
IGL02303:Otoa	APN	7	121132924	critical splice donor site	probably null
IGL02390:Otoa	APN	7	121131367	missense	possibly damaging	0.84
IGL02591:Otoa	APN	7	121155830	missense	probably damaging	1.00
IGL02811:Otoa	APN	7	121118655	missense	possibly damaging	0.60
IGL02878:Otoa	APN	7	121143853	missense	probably damaging	1.00
IGL03328:Otoa	APN	7	121110994	missense	probably damaging	0.98
R0056:Otoa	UTSW	7	121131347	missense	probably benign	0.00
R0279:Otoa	UTSW	7	121111079	splice site	probably benign
R0390:Otoa	UTSW	7	121131341	missense	probably benign	0.07
R0411:Otoa	UTSW	7	121156527	critical splice donor site	probably null
R0628:Otoa	UTSW	7	121145650	splice site	probably benign
R1113:Otoa	UTSW	7	121125443	nonsense	probably null
R1240:Otoa	UTSW	7	121156490	missense	probably benign
R1308:Otoa	UTSW	7	121125443	nonsense	probably null
R1692:Otoa	UTSW	7	121091551	missense	probably damaging	0.99
R1728:Otoa	UTSW	7	121125439	missense	probably benign	0.36
R1729:Otoa	UTSW	7	121125439	missense	probably benign	0.36
R1744:Otoa	UTSW	7	121127776	splice site	probably benign
R1759:Otoa	UTSW	7	121134103	missense	probably damaging	1.00
R1784:Otoa	UTSW	7	121125439	missense	probably benign	0.36
R1817:Otoa	UTSW	7	121160530	utr 3 prime	probably benign
R1961:Otoa	UTSW	7	121118569	missense	probably benign	0.05
R2061:Otoa	UTSW	7	121131328	missense	probably damaging	1.00
R2509:Otoa	UTSW	7	121160472	missense	probably benign
R2510:Otoa	UTSW	7	121160472	missense	probably benign
R3411:Otoa	UTSW	7	121122043	missense	probably damaging	1.00
R3438:Otoa	UTSW	7	121160343	missense	possibly damaging	0.80
R3905:Otoa	UTSW	7	121125565	missense	probably damaging	1.00
R3907:Otoa	UTSW	7	121125565	missense	probably damaging	1.00
R4613:Otoa	UTSW	7	121145568	missense	probably damaging	1.00
R4751:Otoa	UTSW	7	121132924	critical splice donor site	probably benign
R4896:Otoa	UTSW	7	121102679	missense	probably damaging	1.00
R4932:Otoa	UTSW	7	121155135	missense	probably damaging	0.98
R5224:Otoa	UTSW	7	121139793	missense	probably damaging	0.98
R5235:Otoa	UTSW	7	121156470	missense	probably damaging	1.00
R5595:Otoa	UTSW	7	121121977	missense	probably damaging	1.00
R5891:Otoa	UTSW	7	121132360	splice site	probably null
R5894:Otoa	UTSW	7	121121869	missense	probably damaging	1.00
R5905:Otoa	UTSW	7	121094601	missense	probably damaging	1.00
R5976:Otoa	UTSW	7	121127713	missense	probably benign	0.00
R6464:Otoa	UTSW	7	121102605	missense	probably damaging	1.00
R6761:Otoa	UTSW	7	121121950	missense	probably damaging	1.00
R6770:Otoa	UTSW	7	121145614	missense	probably benign	0.25
R6821:Otoa	UTSW	7	121092847	critical splice donor site	probably null
R6924:Otoa	UTSW	7	121131501	splice site	probably null
R7016:Otoa	UTSW	7	121147766	missense	probably damaging	0.99
R7313:Otoa	UTSW	7	121102542	missense	probably benign	0.42
R7340:Otoa	UTSW	7	121130065	missense	probably benign	0.38
R7443:Otoa	UTSW	7	121132410	missense	probably benign	0.00
R7559:Otoa	UTSW	7	121143926	missense	probably damaging	0.99
R7640:Otoa	UTSW	7	121145626	missense	probably damaging	1.00
R7654:Otoa	UTSW	7	121147700	missense	probably damaging	1.00
R7659:Otoa	UTSW	7	121134044	missense	probably benign	0.01
R8421:Otoa	UTSW	7	121099268	critical splice donor site	probably null
R8799:Otoa	UTSW	7	121092671	missense	possibly damaging	0.56
R8954:Otoa	UTSW	7	121145518	nonsense	probably null
R9099:Otoa	UTSW	7	121139832	missense	probably benign
R9126:Otoa	UTSW	7	121094622	missense	probably damaging	1.00
R9369:Otoa	UTSW	7	121145617	missense	probably benign	0.23
U24488:Otoa	UTSW	7	121118540	critical splice acceptor site	probably null
X0023:Otoa	UTSW	7	121118571	missense	probably benign	0.00
Z1177:Otoa	UTSW	7	121118655	missense	probably benign	0.00

Predicted Primers

PCR Primer
(F):5'- AGCTGATGATCCAGGTAGGTG -3'
(R):5'- AACACACCCATGTTTTGTCTACAC -3'

Sequencing Primer
(F):5'- ATCCAGGTAGGTGGTGCAG -3'
(R):5'- CATCTGCCAGGATTGAAGTGC -3'

Posted On

2019-09-06