Incidental Mutation 'R7215:Galns'
ID 568668
Institutional Source Beutler Lab
Gene Symbol Galns
Ensembl Gene ENSMUSG00000015027
Gene Name galactosamine (N-acetyl)-6-sulfatase
Synonyms N-acetylgalactosamine-6-sulfate sulfatase
MMRRC Submission 045287-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R7215 (G1)
Quality Score 225.009
Status Validated
Chromosome 8
Chromosomal Location 123304981-123338202 bp(-) (GRCm39)
Type of Mutation splice site
DNA Base Change (assembly) A to T at 123326087 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000148591 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000015171] [ENSMUST00000127664] [ENSMUST00000212319]
AlphaFold Q571E4
Predicted Effect probably null
Transcript: ENSMUST00000015171
SMART Domains Protein: ENSMUSP00000015171
Gene: ENSMUSG00000015027

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Pfam:Sulfatase 28 353 2.3e-91 PFAM
Pfam:Phosphodiest 30 315 2.1e-11 PFAM
Pfam:Sulfatase_C 376 507 2.4e-34 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000127664
SMART Domains Protein: ENSMUSP00000118564
Gene: ENSMUSG00000092329

DomainStartEndE-ValueType
Pfam:Glycos_transf_2 104 287 7.4e-31 PFAM
Pfam:Glyco_transf_7C 261 331 4.9e-8 PFAM
RICIN 406 531 9.28e-27 SMART
Predicted Effect probably null
Transcript: ENSMUST00000212319
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency 98% (79/81)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes N-acetylgalactosamine-6-sulfatase which is a lysosomal exohydrolase required for the degradation of the glycosaminoglycans, keratan sulfate, and chondroitin 6-sulfate. Sequence alterations including point, missense and nonsense mutations, as well as those that affect splicing, result in a deficiency of this enzyme. Deficiencies of this enzyme lead to Morquio A syndrome, a lysosomal storage disorder. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutant mice are viable, fertile, and healthy in spite of lysosmal storage. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 82 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2210408I21Rik G A 13: 77,471,690 (GRCm39) V1032M possibly damaging Het
Abca13 T A 11: 9,238,405 (GRCm39) probably null Het
Adamts14 T A 10: 61,047,375 (GRCm39) H739L possibly damaging Het
Adgrl3 A G 5: 81,841,397 (GRCm39) E758G probably damaging Het
Ano3 T A 2: 110,496,277 (GRCm39) T826S probably damaging Het
Arhgap45 C T 10: 79,861,316 (GRCm39) T493I possibly damaging Het
Atg9b A C 5: 24,593,039 (GRCm39) W455G probably damaging Het
Atp4a A G 7: 30,416,785 (GRCm39) N496S possibly damaging Het
Bckdk T A 7: 127,504,282 (GRCm39) D60E possibly damaging Het
Blmh A T 11: 76,856,725 (GRCm39) K244* probably null Het
Btbd17 T C 11: 114,682,291 (GRCm39) I474V possibly damaging Het
C87436 A G 6: 86,439,662 (GRCm39) E451G possibly damaging Het
Camta1 T C 4: 151,229,194 (GRCm39) E546G probably damaging Het
Casp1 A G 9: 5,298,523 (GRCm39) probably null Het
Ccdc116 A G 16: 16,957,792 (GRCm39) Y456H probably damaging Het
Cep350 A C 1: 155,770,453 (GRCm39) S1812R possibly damaging Het
Chrna10 A G 7: 101,761,415 (GRCm39) L392P possibly damaging Het
Col22a1 A T 15: 71,842,181 (GRCm39) C434* probably null Het
Cxcl9 G A 5: 92,471,747 (GRCm39) Q98* probably null Het
Cyp2c54 G A 19: 40,034,626 (GRCm39) T348I probably damaging Het
Dnah7a G A 1: 53,657,509 (GRCm39) R756C probably damaging Het
Dnajc18 T C 18: 35,815,034 (GRCm39) T239A probably benign Het
Dnase2a A T 8: 85,636,399 (GRCm39) probably null Het
Dpyd A G 3: 119,059,681 (GRCm39) T793A probably benign Het
Edil3 T C 13: 88,970,169 (GRCm39) probably null Het
Ehd1 T A 19: 6,347,672 (GRCm39) I342N possibly damaging Het
Erbb4 A T 1: 68,378,619 (GRCm39) S341T probably benign Het
Ezh1 T A 11: 101,106,125 (GRCm39) T87S probably benign Het
Fam20b A T 1: 156,518,123 (GRCm39) W224R probably damaging Het
Gm13283 C T 4: 88,678,967 (GRCm39) probably benign Het
Gm49342 A T 14: 51,182,040 (GRCm39) M23L probably benign Het
Gm5114 T A 7: 39,060,795 (GRCm39) H18L probably benign Het
Gpr89 A G 3: 96,787,404 (GRCm39) W299R probably damaging Het
Hadha G T 5: 30,324,840 (GRCm39) N755K probably benign Het
Inpp5d A T 1: 87,628,940 (GRCm39) H620L probably benign Het
Klk1b3 T A 7: 43,849,828 (GRCm39) probably null Het
Macf1 T C 4: 123,401,097 (GRCm39) T663A probably damaging Het
Man1b1 A G 2: 25,240,402 (GRCm39) N601S probably benign Het
Mbtps1 A G 8: 120,251,307 (GRCm39) V605A possibly damaging Het
Med23 C G 10: 24,764,327 (GRCm39) D311E probably benign Het
Myo3a G T 2: 22,250,378 (GRCm39) D82Y possibly damaging Het
Nsd1 T A 13: 55,395,454 (GRCm39) D1121E probably benign Het
Odad1 C T 7: 45,586,046 (GRCm39) R148C probably damaging Het
Or4c116 G A 2: 88,942,845 (GRCm39) Q4* probably null Het
Or5al1 C T 2: 85,989,800 (GRCm39) V305I probably benign Het
Or8b3b A G 9: 38,584,743 (GRCm39) I12T probably benign Het
Otoa T C 7: 120,717,795 (GRCm39) V19A unknown Het
Pcdhb20 A T 18: 37,638,439 (GRCm39) T322S probably benign Het
Pecam1 T C 11: 106,586,745 (GRCm39) T257A probably benign Het
Pi16 G T 17: 29,538,072 (GRCm39) probably benign Het
Pik3c2g C T 6: 139,700,589 (GRCm39) T293M Het
Pira13 C T 7: 3,825,310 (GRCm39) C444Y unknown Het
Pkhd1l1 T A 15: 44,391,559 (GRCm39) C1542S possibly damaging Het
Prrc2b G A 2: 32,119,309 (GRCm39) G2172R probably damaging Het
Prrt1 A T 17: 34,848,677 (GRCm39) probably null Het
Ptprb T A 10: 116,174,681 (GRCm39) N784K possibly damaging Het
Rem1 C A 2: 152,470,069 (GRCm39) S18R probably damaging Het
Ripk4 G A 16: 97,548,523 (GRCm39) probably null Het
Scn8a G A 15: 100,927,711 (GRCm39) V1397I possibly damaging Het
Setbp1 T A 18: 78,900,052 (GRCm39) H1205L probably damaging Het
Shmt1 T C 11: 60,692,361 (GRCm39) I132V probably damaging Het
Slc24a1 T A 9: 64,835,785 (GRCm39) T781S unknown Het
Sncaip C T 18: 53,040,415 (GRCm39) Q870* probably null Het
Stab1 A T 14: 30,882,754 (GRCm39) N416K possibly damaging Het
Tcea1 A G 1: 4,937,706 (GRCm39) D26G probably damaging Het
Tcf20 A T 15: 82,737,690 (GRCm39) S1254T probably benign Het
Tead4 T A 6: 128,205,641 (GRCm39) I354F probably damaging Het
Tex36 G A 7: 133,189,147 (GRCm39) R142* probably null Het
Trav6d-3 T A 14: 52,962,799 (GRCm39) L12Q probably damaging Het
Trpc4 A G 3: 54,102,317 (GRCm39) T72A possibly damaging Het
Trrap G A 5: 144,733,945 (GRCm39) A933T probably benign Het
Tspoap1 T A 11: 87,661,315 (GRCm39) I589N probably benign Het
Ttll5 T A 12: 85,980,170 (GRCm39) V918E probably benign Het
Tut4 T C 4: 108,384,205 (GRCm39) Y1091H probably damaging Het
Txn2 A G 15: 77,811,886 (GRCm39) probably null Het
Ucn3 T G 13: 3,991,365 (GRCm39) T96P probably benign Het
Usp36 T C 11: 118,155,980 (GRCm39) E764G possibly damaging Het
Vmn2r23 A T 6: 123,681,323 (GRCm39) H77L probably benign Het
Vmn2r57 T C 7: 41,049,710 (GRCm39) T680A probably benign Het
Vwa3a T C 7: 120,394,853 (GRCm39) I891T possibly damaging Het
Zfp764l1 A G 7: 126,990,695 (GRCm39) S431P probably benign Het
Zhx2 A G 15: 57,687,039 (GRCm39) I803V probably benign Het
Other mutations in Galns
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02173:Galns APN 8 123,325,365 (GRCm39) missense probably damaging 1.00
IGL02401:Galns APN 8 123,331,938 (GRCm39) missense probably damaging 1.00
brimstone UTSW 8 123,327,349 (GRCm39) missense probably damaging 1.00
fiend UTSW 8 123,338,077 (GRCm39) start codon destroyed probably null
vesuvius UTSW 8 123,326,087 (GRCm39) splice site probably null
R0001:Galns UTSW 8 123,322,622 (GRCm39) splice site probably benign
R0018:Galns UTSW 8 123,311,724 (GRCm39) missense probably benign 0.09
R1417:Galns UTSW 8 123,311,652 (GRCm39) missense possibly damaging 0.71
R1636:Galns UTSW 8 123,330,955 (GRCm39) splice site probably benign
R4729:Galns UTSW 8 123,330,195 (GRCm39) missense probably damaging 1.00
R4851:Galns UTSW 8 123,327,272 (GRCm39) missense probably damaging 1.00
R4891:Galns UTSW 8 123,325,895 (GRCm39) missense possibly damaging 0.92
R5218:Galns UTSW 8 123,325,328 (GRCm39) missense probably damaging 0.99
R5532:Galns UTSW 8 123,311,765 (GRCm39) missense possibly damaging 0.83
R6323:Galns UTSW 8 123,325,390 (GRCm39) missense probably damaging 1.00
R6444:Galns UTSW 8 123,338,077 (GRCm39) start codon destroyed probably null
R6495:Galns UTSW 8 123,327,349 (GRCm39) missense probably damaging 1.00
R7608:Galns UTSW 8 123,318,184 (GRCm39) missense probably benign 0.06
R7612:Galns UTSW 8 123,311,693 (GRCm39) missense possibly damaging 0.71
R9568:Galns UTSW 8 123,311,649 (GRCm39) critical splice donor site probably null
Z1177:Galns UTSW 8 123,331,945 (GRCm39) missense probably damaging 1.00
Z1177:Galns UTSW 8 123,325,262 (GRCm39) missense probably benign 0.11
Predicted Primers PCR Primer
(F):5'- AAAAGGCCTCCGTTCTCCTC -3'
(R):5'- GATCCAGCTCAAAGGATTTGGTC -3'

Sequencing Primer
(F):5'- CTGCTGCAGGCCAATTCATC -3'
(R):5'- ATGTGTGCACCTACAGCATG -3'
Posted On 2019-09-06