Incidental Mutation 'R7215:Casp1'
ID568669
Institutional Source Beutler Lab
Gene Symbol Casp1
Ensembl Gene ENSMUSG00000025888
Gene Namecaspase 1
SynonymsICE, Il1bc, Caspase-1, interleukin 1 beta-converting enzyme
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7215 (G1)
Quality Score110.008
Status Validated
Chromosome9
Chromosomal Location5298517-5307265 bp(+) (GRCm38)
Type of Mutationutr 5 prime
DNA Base Change (assembly) A to G at 5298523 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000027015 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027015]
Predicted Effect probably null
Transcript: ENSMUST00000027015
SMART Domains Protein: ENSMUSP00000027015
Gene: ENSMUSG00000025888

DomainStartEndE-ValueType
CARD 4 89 4.91e-19 SMART
CASc 151 400 1.82e-136 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency 98% (79/81)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein which is a member of the cysteine-aspartic acid protease (caspase) family. Sequential activation of caspases plays a central role in the execution-phase of cell apoptosis. Caspases exist as inactive proenzymes which undergo proteolytic processing at conserved aspartic residues to produce 2 subunits, large and small, that dimerize to form the active enzyme. This gene was identified by its ability to proteolytically cleave and activate the inactive precursor of interleukin-1, a cytokine involved in the processes such as inflammation, septic shock, and wound healing. This gene has been shown to induce cell apoptosis and may function in various developmental stages. Studies of a similar gene in mouse suggest a role in the pathogenesis of Huntington disease. Alternative splicing results in transcript variants encoding distinct isoforms. [provided by RefSeq, Mar 2012]
PHENOTYPE: Homozygous targeted mutants fail to produce mature IL1A and IL1B and are resistant to LPS-induced endotoxin shock and to FAS antibody-induced apoptosis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 82 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2210408I21Rik G A 13: 77,323,571 V1032M possibly damaging Het
Abca13 T A 11: 9,288,405 probably null Het
Adamts14 T A 10: 61,211,596 H739L possibly damaging Het
Adgrl3 A G 5: 81,693,550 E758G probably damaging Het
Ano3 T A 2: 110,665,932 T826S probably damaging Het
Arhgap45 C T 10: 80,025,482 T493I possibly damaging Het
Atg9b A C 5: 24,388,041 W455G probably damaging Het
Atp4a A G 7: 30,717,360 N496S possibly damaging Het
Bckdk T A 7: 127,905,110 D60E possibly damaging Het
Blmh A T 11: 76,965,899 K244* probably null Het
Btbd17 T C 11: 114,791,465 I474V possibly damaging Het
C87436 A G 6: 86,462,680 E451G possibly damaging Het
Camta1 T C 4: 151,144,737 E546G probably damaging Het
Ccdc114 C T 7: 45,936,622 R148C probably damaging Het
Ccdc116 A G 16: 17,139,928 Y456H probably damaging Het
Cep350 A C 1: 155,894,707 S1812R possibly damaging Het
Chrna10 A G 7: 102,112,208 L392P possibly damaging Het
Col22a1 A T 15: 71,970,332 C434* probably null Het
Cxcl9 G A 5: 92,323,888 Q98* probably null Het
Cyp2c54 G A 19: 40,046,182 T348I probably damaging Het
Dnah7a G A 1: 53,618,350 R756C probably damaging Het
Dnajc18 T C 18: 35,681,981 T239A probably benign Het
Dnase2a A T 8: 84,909,770 probably null Het
Dpyd A G 3: 119,266,032 T793A probably benign Het
E430018J23Rik A G 7: 127,391,523 S431P probably benign Het
Edil3 T C 13: 88,822,050 probably null Het
Ehd1 T A 19: 6,297,642 I342N possibly damaging Het
Erbb4 A T 1: 68,339,460 S341T probably benign Het
Ezh1 T A 11: 101,215,299 T87S probably benign Het
Fam20b A T 1: 156,690,553 W224R probably damaging Het
Galns A T 8: 122,599,348 probably null Het
Gm13283 C T 4: 88,760,730 probably benign Het
Gm15448 C T 7: 3,822,311 C444Y unknown Het
Gm49342 A T 14: 50,944,583 M23L probably benign Het
Gm5114 T A 7: 39,411,371 H18L probably benign Het
Gpr89 A G 3: 96,880,088 W299R probably damaging Het
Hadha G T 5: 30,119,842 N755K probably benign Het
Inpp5d A T 1: 87,701,218 H620L probably benign Het
Klk1b3 T A 7: 44,200,404 probably null Het
Macf1 T C 4: 123,507,304 T663A probably damaging Het
Man1b1 A G 2: 25,350,390 N601S probably benign Het
Mbtps1 A G 8: 119,524,568 V605A possibly damaging Het
Med23 C G 10: 24,888,429 D311E probably benign Het
Myo3a G T 2: 22,245,567 D82Y possibly damaging Het
Nsd1 T A 13: 55,247,641 D1121E probably benign Het
Olfr1042 C T 2: 86,159,456 V305I probably benign Het
Olfr1221 G A 2: 89,112,501 Q4* probably null Het
Olfr918 A G 9: 38,673,447 I12T probably benign Het
Otoa T C 7: 121,118,572 V19A unknown Het
Pcdhb20 A T 18: 37,505,386 T322S probably benign Het
Pecam1 T C 11: 106,695,919 T257A probably benign Het
Pi16 G T 17: 29,319,098 probably benign Het
Pik3c2g C T 6: 139,754,863 T293M Het
Pkhd1l1 T A 15: 44,528,163 C1542S possibly damaging Het
Prrc2b G A 2: 32,229,297 G2172R probably damaging Het
Prrt1 A T 17: 34,629,703 probably null Het
Ptprb T A 10: 116,338,776 N784K possibly damaging Het
Rem1 C A 2: 152,628,149 S18R probably damaging Het
Ripk4 G A 16: 97,747,323 probably null Het
Scn8a G A 15: 101,029,830 V1397I possibly damaging Het
Setbp1 T A 18: 78,856,837 H1205L probably damaging Het
Shmt1 T C 11: 60,801,535 I132V probably damaging Het
Slc24a1 T A 9: 64,928,503 T781S unknown Het
Sncaip C T 18: 52,907,343 Q870* probably null Het
Stab1 A T 14: 31,160,797 N416K possibly damaging Het
Tcea1 A G 1: 4,867,483 D26G probably damaging Het
Tcf20 A T 15: 82,853,489 S1254T probably benign Het
Tead4 T A 6: 128,228,678 I354F probably damaging Het
Tex36 G A 7: 133,587,418 R142* probably null Het
Trav6d-3 T A 14: 52,725,342 L12Q probably damaging Het
Trpc4 A G 3: 54,194,896 T72A possibly damaging Het
Trrap G A 5: 144,797,135 A933T probably benign Het
Tspoap1 T A 11: 87,770,489 I589N probably benign Het
Ttll5 T A 12: 85,933,396 V918E probably benign Het
Txn2 A G 15: 77,927,686 probably null Het
Ucn3 T G 13: 3,941,365 T96P probably benign Het
Usp36 T C 11: 118,265,154 E764G possibly damaging Het
Vmn2r23 A T 6: 123,704,364 H77L probably benign Het
Vmn2r57 T C 7: 41,400,286 T680A probably benign Het
Vwa3a T C 7: 120,795,630 I891T possibly damaging Het
Zcchc11 T C 4: 108,527,008 Y1091H probably damaging Het
Zhx2 A G 15: 57,823,643 I803V probably benign Het
Other mutations in Casp1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00235:Casp1 APN 9 5299872 splice site probably benign
IGL00667:Casp1 APN 9 5303756 missense probably benign 0.40
IGL01998:Casp1 APN 9 5303043 missense probably damaging 1.00
IGL02248:Casp1 APN 9 5299452 missense probably benign 0.01
IGL02469:Casp1 APN 9 5303105 missense probably benign 0.19
P0027:Casp1 UTSW 9 5299851 missense probably benign 0.00
PIT4305001:Casp1 UTSW 9 5306135 missense probably benign 0.03
R0724:Casp1 UTSW 9 5303077 missense probably benign
R1169:Casp1 UTSW 9 5299454 missense possibly damaging 0.93
R1876:Casp1 UTSW 9 5303663 missense probably benign 0.01
R2316:Casp1 UTSW 9 5306213 missense possibly damaging 0.92
R2877:Casp1 UTSW 9 5303110 missense probably damaging 1.00
R2885:Casp1 UTSW 9 5299851 missense probably benign 0.00
R4043:Casp1 UTSW 9 5302444 missense probably benign
R4367:Casp1 UTSW 9 5299333 missense probably benign 0.41
R4656:Casp1 UTSW 9 5304324 missense probably damaging 1.00
R4705:Casp1 UTSW 9 5306204 missense probably damaging 1.00
R4790:Casp1 UTSW 9 5303020 missense probably benign 0.01
R4858:Casp1 UTSW 9 5306742 missense probably damaging 1.00
R5607:Casp1 UTSW 9 5303143 missense probably damaging 1.00
R5784:Casp1 UTSW 9 5299337 missense probably damaging 0.98
R6578:Casp1 UTSW 9 5304280 missense probably benign 0.04
R7111:Casp1 UTSW 9 5299816 missense probably benign 0.01
R7590:Casp1 UTSW 9 5306710 missense probably damaging 1.00
T0722:Casp1 UTSW 9 5299851 missense probably benign 0.00
X0003:Casp1 UTSW 9 5299851 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- GTATCCTTATCGACGATACTTATGC -3'
(R):5'- TCTTTTCTACACCGCAGAGC -3'

Sequencing Primer
(F):5'- GTTTGACAGTAGATGCACACCTCTG -3'
(R):5'- GAGCTACTGAAACTGAAAGCATATTG -3'
Posted On2019-09-06