Mutagenetix > Incidental Mutation

Incidental Mutation 'R7215:Casp1'

568669

Institutional Source

Beutler Lab

Gene Symbol

Casp1

Ensembl Gene

ENSMUSG00000025888

Gene Name

caspase 1

Synonyms

ICE, Il1bc, Caspase-1, interleukin 1 beta-converting enzyme

MMRRC Submission

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R7215 (G1)

Quality Score

110.008

Status

Validated

Chromosome

Chromosomal Location

5298517-5307265 bp(+) (GRCm38)

Type of Mutation

splice site

DNA Base Change (assembly)

A to G at 5298523 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000027015 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000027015]

AlphaFold

P29452

Predicted Effect

probably null
Transcript: ENSMUST00000027015

SMART Domains

Protein: ENSMUSP00000027015
Gene: ENSMUSG00000025888

Domain	Start	End	E-Value	Type
CARD	4	89	4.91e-19	SMART
CASc	151	400	1.82e-136	SMART

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.6%
20x: 98.8%

Validation Efficiency

98% (79/81)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein which is a member of the cysteine-aspartic acid protease (caspase) family. Sequential activation of caspases plays a central role in the execution-phase of cell apoptosis. Caspases exist as inactive proenzymes which undergo proteolytic processing at conserved aspartic residues to produce 2 subunits, large and small, that dimerize to form the active enzyme. This gene was identified by its ability to proteolytically cleave and activate the inactive precursor of interleukin-1, a cytokine involved in the processes such as inflammation, septic shock, and wound healing. This gene has been shown to induce cell apoptosis and may function in various developmental stages. Studies of a similar gene in mouse suggest a role in the pathogenesis of Huntington disease. Alternative splicing results in transcript variants encoding distinct isoforms. [provided by RefSeq, Mar 2012]
PHENOTYPE: Homozygous targeted mutants fail to produce mature IL1A and IL1B and are resistant to LPS-induced endotoxin shock and to FAS antibody-induced apoptosis. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 82 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2210408I21Rik	G	A	13: 77,323,571	V1032M	possibly damaging	Het
Abca13	T	A	11: 9,288,405		probably null	Het
Adamts14	T	A	10: 61,211,596	H739L	possibly damaging	Het
Adgrl3	A	G	5: 81,693,550	E758G	probably damaging	Het
Ano3	T	A	2: 110,665,932	T826S	probably damaging	Het
Arhgap45	C	T	10: 80,025,482	T493I	possibly damaging	Het
Atg9b	A	C	5: 24,388,041	W455G	probably damaging	Het
Atp4a	A	G	7: 30,717,360	N496S	possibly damaging	Het
Bckdk	T	A	7: 127,905,110	D60E	possibly damaging	Het
Blmh	A	T	11: 76,965,899	K244*	probably null	Het
Btbd17	T	C	11: 114,791,465	I474V	possibly damaging	Het
C87436	A	G	6: 86,462,680	E451G	possibly damaging	Het
Camta1	T	C	4: 151,144,737	E546G	probably damaging	Het
Ccdc114	C	T	7: 45,936,622	R148C	probably damaging	Het
Ccdc116	A	G	16: 17,139,928	Y456H	probably damaging	Het
Cep350	A	C	1: 155,894,707	S1812R	possibly damaging	Het
Chrna10	A	G	7: 102,112,208	L392P	possibly damaging	Het
Col22a1	A	T	15: 71,970,332	C434*	probably null	Het
Cxcl9	G	A	5: 92,323,888	Q98*	probably null	Het
Cyp2c54	G	A	19: 40,046,182	T348I	probably damaging	Het
Dnah7a	G	A	1: 53,618,350	R756C	probably damaging	Het
Dnajc18	T	C	18: 35,681,981	T239A	probably benign	Het
Dnase2a	A	T	8: 84,909,770		probably null	Het
Dpyd	A	G	3: 119,266,032	T793A	probably benign	Het
E430018J23Rik	A	G	7: 127,391,523	S431P	probably benign	Het
Edil3	T	C	13: 88,822,050		probably null	Het
Ehd1	T	A	19: 6,297,642	I342N	possibly damaging	Het
Erbb4	A	T	1: 68,339,460	S341T	probably benign	Het
Ezh1	T	A	11: 101,215,299	T87S	probably benign	Het
Fam20b	A	T	1: 156,690,553	W224R	probably damaging	Het
Galns	A	T	8: 122,599,348		probably null	Het
Gm13283	C	T	4: 88,760,730		probably benign	Het
Gm15448	C	T	7: 3,822,311	C444Y	unknown	Het
Gm49342	A	T	14: 50,944,583	M23L	probably benign	Het
Gm5114	T	A	7: 39,411,371	H18L	probably benign	Het
Gpr89	A	G	3: 96,880,088	W299R	probably damaging	Het
Hadha	G	T	5: 30,119,842	N755K	probably benign	Het
Inpp5d	A	T	1: 87,701,218	H620L	probably benign	Het
Klk1b3	T	A	7: 44,200,404		probably null	Het
Macf1	T	C	4: 123,507,304	T663A	probably damaging	Het
Man1b1	A	G	2: 25,350,390	N601S	probably benign	Het
Mbtps1	A	G	8: 119,524,568	V605A	possibly damaging	Het
Med23	C	G	10: 24,888,429	D311E	probably benign	Het
Myo3a	G	T	2: 22,245,567	D82Y	possibly damaging	Het
Nsd1	T	A	13: 55,247,641	D1121E	probably benign	Het
Olfr1042	C	T	2: 86,159,456	V305I	probably benign	Het
Olfr1221	G	A	2: 89,112,501	Q4*	probably null	Het
Olfr918	A	G	9: 38,673,447	I12T	probably benign	Het
Otoa	T	C	7: 121,118,572	V19A	unknown	Het
Pcdhb20	A	T	18: 37,505,386	T322S	probably benign	Het
Pecam1	T	C	11: 106,695,919	T257A	probably benign	Het
Pi16	G	T	17: 29,319,098		probably benign	Het
Pik3c2g	C	T	6: 139,754,863	T293M		Het
Pkhd1l1	T	A	15: 44,528,163	C1542S	possibly damaging	Het
Prrc2b	G	A	2: 32,229,297	G2172R	probably damaging	Het
Prrt1	A	T	17: 34,629,703		probably null	Het
Ptprb	T	A	10: 116,338,776	N784K	possibly damaging	Het
Rem1	C	A	2: 152,628,149	S18R	probably damaging	Het
Ripk4	G	A	16: 97,747,323		probably null	Het
Scn8a	G	A	15: 101,029,830	V1397I	possibly damaging	Het
Setbp1	T	A	18: 78,856,837	H1205L	probably damaging	Het
Shmt1	T	C	11: 60,801,535	I132V	probably damaging	Het
Slc24a1	T	A	9: 64,928,503	T781S	unknown	Het
Sncaip	C	T	18: 52,907,343	Q870*	probably null	Het
Stab1	A	T	14: 31,160,797	N416K	possibly damaging	Het
Tcea1	A	G	1: 4,867,483	D26G	probably damaging	Het
Tcf20	A	T	15: 82,853,489	S1254T	probably benign	Het
Tead4	T	A	6: 128,228,678	I354F	probably damaging	Het
Tex36	G	A	7: 133,587,418	R142*	probably null	Het
Trav6d-3	T	A	14: 52,725,342	L12Q	probably damaging	Het
Trpc4	A	G	3: 54,194,896	T72A	possibly damaging	Het
Trrap	G	A	5: 144,797,135	A933T	probably benign	Het
Tspoap1	T	A	11: 87,770,489	I589N	probably benign	Het
Ttll5	T	A	12: 85,933,396	V918E	probably benign	Het
Txn2	A	G	15: 77,927,686		probably null	Het
Ucn3	T	G	13: 3,941,365	T96P	probably benign	Het
Usp36	T	C	11: 118,265,154	E764G	possibly damaging	Het
Vmn2r23	A	T	6: 123,704,364	H77L	probably benign	Het
Vmn2r57	T	C	7: 41,400,286	T680A	probably benign	Het
Vwa3a	T	C	7: 120,795,630	I891T	possibly damaging	Het
Zcchc11	T	C	4: 108,527,008	Y1091H	probably damaging	Het
Zhx2	A	G	15: 57,823,643	I803V	probably benign	Het

Other mutations in Casp1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00235:Casp1	APN	9	5299872	splice site	probably benign
IGL00667:Casp1	APN	9	5303756	missense	probably benign	0.40
IGL01998:Casp1	APN	9	5303043	missense	probably damaging	1.00
IGL02248:Casp1	APN	9	5299452	missense	probably benign	0.01
IGL02469:Casp1	APN	9	5303105	missense	probably benign	0.19
P0027:Casp1	UTSW	9	5299851	missense	probably benign	0.00
PIT4305001:Casp1	UTSW	9	5306135	missense	probably benign	0.03
R0724:Casp1	UTSW	9	5303077	missense	probably benign
R1169:Casp1	UTSW	9	5299454	missense	possibly damaging	0.93
R1876:Casp1	UTSW	9	5303663	missense	probably benign	0.01
R2316:Casp1	UTSW	9	5306213	missense	possibly damaging	0.92
R2877:Casp1	UTSW	9	5303110	missense	probably damaging	1.00
R2885:Casp1	UTSW	9	5299851	missense	probably benign	0.00
R4043:Casp1	UTSW	9	5302444	missense	probably benign
R4367:Casp1	UTSW	9	5299333	missense	probably benign	0.41
R4656:Casp1	UTSW	9	5304324	missense	probably damaging	1.00
R4705:Casp1	UTSW	9	5306204	missense	probably damaging	1.00
R4790:Casp1	UTSW	9	5303020	missense	probably benign	0.01
R4858:Casp1	UTSW	9	5306742	missense	probably damaging	1.00
R5607:Casp1	UTSW	9	5303143	missense	probably damaging	1.00
R5784:Casp1	UTSW	9	5299337	missense	probably damaging	0.98
R6578:Casp1	UTSW	9	5304280	missense	probably benign	0.04
R7111:Casp1	UTSW	9	5299816	missense	probably benign	0.01
R7590:Casp1	UTSW	9	5306710	missense	probably damaging	1.00
R8002:Casp1	UTSW	9	5303164	missense	possibly damaging	0.94
R8510:Casp1	UTSW	9	5303026	missense	probably damaging	1.00
R8902:Casp1	UTSW	9	5299333	missense	probably benign	0.41
R9234:Casp1	UTSW	9	5303128	missense	probably benign	0.04
R9471:Casp1	UTSW	9	5304187	missense	probably benign	0.13
R9747:Casp1	UTSW	9	5299322	missense	probably damaging	1.00
T0722:Casp1	UTSW	9	5299851	missense	probably benign	0.00
X0003:Casp1	UTSW	9	5299851	missense	probably benign	0.00

Predicted Primers

PCR Primer
(F):5'- GTATCCTTATCGACGATACTTATGC -3'
(R):5'- TCTTTTCTACACCGCAGAGC -3'

Sequencing Primer
(F):5'- GTTTGACAGTAGATGCACACCTCTG -3'
(R):5'- GAGCTACTGAAACTGAAAGCATATTG -3'

Posted On

2019-09-06