Mutagenetix > Incidental Mutation

Incidental Mutation 'R7215:Txn2'

568671

Institutional Source

Beutler Lab

Gene Symbol

Txn2

Ensembl Gene

ENSMUSG00000005354

Gene Name

thioredoxin 2

Synonyms

Trx2, 2510006J11Rik

MMRRC Submission

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R7215 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

77915047-77929006 bp(-) (GRCm38)

Type of Mutation

splice site (6 bp from exon)

DNA Base Change (assembly)

A to G at 77927686 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000133605 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000005487] [ENSMUST00000100486] [ENSMUST00000109747] [ENSMUST00000109748] [ENSMUST00000174529]

AlphaFold

P97493

Predicted Effect

probably null
Transcript: ENSMUST00000005487

SMART Domains

Protein: ENSMUSP00000005487
Gene: ENSMUSG00000005354

Domain	Start	End	E-Value	Type
Pfam:Thioredoxin	61	164	7.8e-31	PFAM
Pfam:Thioredoxin_7	72	141	5.1e-9	PFAM
Pfam:Thioredoxin_2	74	161	2.4e-9	PFAM

Predicted Effect

probably null
Transcript: ENSMUST00000100486

SMART Domains

Protein: ENSMUSP00000098055
Gene: ENSMUSG00000005354

Domain	Start	End	E-Value	Type
PDB:1W89\|F	60	88	9e-14	PDB

Predicted Effect

probably null
Transcript: ENSMUST00000109747

SMART Domains

Protein: ENSMUSP00000105369
Gene: ENSMUSG00000005354

Domain	Start	End	E-Value	Type
Pfam:Thioredoxin	61	138	3.3e-21	PFAM

Predicted Effect

probably null
Transcript: ENSMUST00000109748

SMART Domains

Protein: ENSMUSP00000105370
Gene: ENSMUSG00000005354

Domain	Start	End	E-Value	Type
Pfam:Thioredoxin	61	164	2.6e-30	PFAM
Pfam:Thioredoxin_2	74	161	1.7e-8	PFAM

Predicted Effect

probably null
Transcript: ENSMUST00000173631

SMART Domains

Protein: ENSMUSP00000134682
Gene: ENSMUSG00000005354

Domain	Start	End	E-Value	Type
Pfam:Thioredoxin	25	128	8.1e-31	PFAM
Pfam:Thioredoxin_2	38	125	4.8e-9	PFAM

Predicted Effect

probably null
Transcript: ENSMUST00000174529

SMART Domains

Protein: ENSMUSP00000133605
Gene: ENSMUSG00000005354

Domain	Start	End	E-Value	Type
Pfam:Thioredoxin	1	62	5.6e-19	PFAM
Pfam:Thioredoxin_7	3	80	1.5e-8	PFAM

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.6%
20x: 98.8%

Validation Efficiency

98% (79/81)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This nuclear gene encodes a mitochondrial member of the thioredoxin family, a group of small multifunctional redox-active proteins. The encoded protein may play important roles in the regulation of the mitochondrial membrane potential and in protection against oxidant-induced apoptosis. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for mutations that inactivate the gene exhibit exencephaly and embyronic lethality. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 82 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2210408I21Rik	G	A	13: 77,323,571	V1032M	possibly damaging	Het
Abca13	T	A	11: 9,288,405		probably null	Het
Adamts14	T	A	10: 61,211,596	H739L	possibly damaging	Het
Adgrl3	A	G	5: 81,693,550	E758G	probably damaging	Het
Ano3	T	A	2: 110,665,932	T826S	probably damaging	Het
Arhgap45	C	T	10: 80,025,482	T493I	possibly damaging	Het
Atg9b	A	C	5: 24,388,041	W455G	probably damaging	Het
Atp4a	A	G	7: 30,717,360	N496S	possibly damaging	Het
Bckdk	T	A	7: 127,905,110	D60E	possibly damaging	Het
Blmh	A	T	11: 76,965,899	K244*	probably null	Het
Btbd17	T	C	11: 114,791,465	I474V	possibly damaging	Het
C87436	A	G	6: 86,462,680	E451G	possibly damaging	Het
Camta1	T	C	4: 151,144,737	E546G	probably damaging	Het
Casp1	A	G	9: 5,298,523		probably null	Het
Ccdc114	C	T	7: 45,936,622	R148C	probably damaging	Het
Ccdc116	A	G	16: 17,139,928	Y456H	probably damaging	Het
Cep350	A	C	1: 155,894,707	S1812R	possibly damaging	Het
Chrna10	A	G	7: 102,112,208	L392P	possibly damaging	Het
Col22a1	A	T	15: 71,970,332	C434*	probably null	Het
Cxcl9	G	A	5: 92,323,888	Q98*	probably null	Het
Cyp2c54	G	A	19: 40,046,182	T348I	probably damaging	Het
Dnah7a	G	A	1: 53,618,350	R756C	probably damaging	Het
Dnajc18	T	C	18: 35,681,981	T239A	probably benign	Het
Dnase2a	A	T	8: 84,909,770		probably null	Het
Dpyd	A	G	3: 119,266,032	T793A	probably benign	Het
E430018J23Rik	A	G	7: 127,391,523	S431P	probably benign	Het
Edil3	T	C	13: 88,822,050		probably null	Het
Ehd1	T	A	19: 6,297,642	I342N	possibly damaging	Het
Erbb4	A	T	1: 68,339,460	S341T	probably benign	Het
Ezh1	T	A	11: 101,215,299	T87S	probably benign	Het
Fam20b	A	T	1: 156,690,553	W224R	probably damaging	Het
Galns	A	T	8: 122,599,348		probably null	Het
Gm13283	C	T	4: 88,760,730		probably benign	Het
Gm15448	C	T	7: 3,822,311	C444Y	unknown	Het
Gm49342	A	T	14: 50,944,583	M23L	probably benign	Het
Gm5114	T	A	7: 39,411,371	H18L	probably benign	Het
Gpr89	A	G	3: 96,880,088	W299R	probably damaging	Het
Hadha	G	T	5: 30,119,842	N755K	probably benign	Het
Inpp5d	A	T	1: 87,701,218	H620L	probably benign	Het
Klk1b3	T	A	7: 44,200,404		probably null	Het
Macf1	T	C	4: 123,507,304	T663A	probably damaging	Het
Man1b1	A	G	2: 25,350,390	N601S	probably benign	Het
Mbtps1	A	G	8: 119,524,568	V605A	possibly damaging	Het
Med23	C	G	10: 24,888,429	D311E	probably benign	Het
Myo3a	G	T	2: 22,245,567	D82Y	possibly damaging	Het
Nsd1	T	A	13: 55,247,641	D1121E	probably benign	Het
Olfr1042	C	T	2: 86,159,456	V305I	probably benign	Het
Olfr1221	G	A	2: 89,112,501	Q4*	probably null	Het
Olfr918	A	G	9: 38,673,447	I12T	probably benign	Het
Otoa	T	C	7: 121,118,572	V19A	unknown	Het
Pcdhb20	A	T	18: 37,505,386	T322S	probably benign	Het
Pecam1	T	C	11: 106,695,919	T257A	probably benign	Het
Pi16	G	T	17: 29,319,098		probably benign	Het
Pik3c2g	C	T	6: 139,754,863	T293M		Het
Pkhd1l1	T	A	15: 44,528,163	C1542S	possibly damaging	Het
Prrc2b	G	A	2: 32,229,297	G2172R	probably damaging	Het
Prrt1	A	T	17: 34,629,703		probably null	Het
Ptprb	T	A	10: 116,338,776	N784K	possibly damaging	Het
Rem1	C	A	2: 152,628,149	S18R	probably damaging	Het
Ripk4	G	A	16: 97,747,323		probably null	Het
Scn8a	G	A	15: 101,029,830	V1397I	possibly damaging	Het
Setbp1	T	A	18: 78,856,837	H1205L	probably damaging	Het
Shmt1	T	C	11: 60,801,535	I132V	probably damaging	Het
Slc24a1	T	A	9: 64,928,503	T781S	unknown	Het
Sncaip	C	T	18: 52,907,343	Q870*	probably null	Het
Stab1	A	T	14: 31,160,797	N416K	possibly damaging	Het
Tcea1	A	G	1: 4,867,483	D26G	probably damaging	Het
Tcf20	A	T	15: 82,853,489	S1254T	probably benign	Het
Tead4	T	A	6: 128,228,678	I354F	probably damaging	Het
Tex36	G	A	7: 133,587,418	R142*	probably null	Het
Trav6d-3	T	A	14: 52,725,342	L12Q	probably damaging	Het
Trpc4	A	G	3: 54,194,896	T72A	possibly damaging	Het
Trrap	G	A	5: 144,797,135	A933T	probably benign	Het
Tspoap1	T	A	11: 87,770,489	I589N	probably benign	Het
Ttll5	T	A	12: 85,933,396	V918E	probably benign	Het
Ucn3	T	G	13: 3,941,365	T96P	probably benign	Het
Usp36	T	C	11: 118,265,154	E764G	possibly damaging	Het
Vmn2r23	A	T	6: 123,704,364	H77L	probably benign	Het
Vmn2r57	T	C	7: 41,400,286	T680A	probably benign	Het
Vwa3a	T	C	7: 120,795,630	I891T	possibly damaging	Het
Zcchc11	T	C	4: 108,527,008	Y1091H	probably damaging	Het
Zhx2	A	G	15: 57,823,643	I803V	probably benign	Het

Other mutations in Txn2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
R0611:Txn2	UTSW	15	77927717	missense	probably damaging	1.00
R0919:Txn2	UTSW	15	77927749	missense	probably damaging	1.00
R2504:Txn2	UTSW	15	77926670	intron	probably benign
R3700:Txn2	UTSW	15	77927776	missense	possibly damaging	0.69
R4515:Txn2	UTSW	15	77915443	splice site	probably null
R5897:Txn2	UTSW	15	77924526	missense	probably benign	0.43
R6879:Txn2	UTSW	15	77919722	intron	probably benign
R7101:Txn2	UTSW	15	77926678	missense	unknown
R9215:Txn2	UTSW	15	77919765	missense	unknown
R9719:Txn2	UTSW	15	77928089	unclassified	probably benign

Predicted Primers

PCR Primer
(F):5'- AGGAAGACCATCAATCTGTCTCC -3'
(R):5'- TCAGTCATCTCCAGGAAGCC -3'

Sequencing Primer
(F):5'- TCCTACCATACTGCATACTTAAGG -3'
(R):5'- GGGCTTCCCTCACCTCTAAGAC -3'

Posted On

2019-09-06