Mutagenetix > Incidental Mutation

Incidental Mutation 'R7215:Ripk4'

568672

Institutional Source

Beutler Lab

Gene Symbol

Ripk4

Ensembl Gene

ENSMUSG00000005251

Gene Name

receptor-interacting serine-threonine kinase 4

Synonyms

Ankrd3, DIk, PKK, ANKK2, RIP4

MMRRC Submission

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.184) question?

Stock #

R7215 (G1)

Quality Score

220.009

Status

Validated

Chromosome

Chromosomal Location

97741933-97763787 bp(-) (GRCm38)

Type of Mutation

splice site

DNA Base Change (assembly)

G to A at 97747323 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000019386 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000019386]

AlphaFold

Q9ERK0

Predicted Effect

probably null
Transcript: ENSMUST00000019386

SMART Domains

Protein: ENSMUSP00000019386
Gene: ENSMUSG00000005251

Domain	Start	End	E-Value	Type
Pfam:Pkinase	22	283	1.8e-47	PFAM
Pfam:Pkinase_Tyr	23	283	6e-45	PFAM
low complexity region	356	396	N/A	INTRINSIC
ANK	439	468	2.58e-3	SMART
ANK	472	501	3.41e-3	SMART
ANK	505	534	7.42e-4	SMART
ANK	538	567	3.57e-6	SMART
ANK	571	601	3.85e-2	SMART
ANK	605	634	3.15e-7	SMART
ANK	638	667	5.16e-3	SMART
ANK	671	700	2.2e-6	SMART
ANK	704	734	1.68e-2	SMART
ANK	736	765	3.46e-4	SMART

Meta Mutation Damage Score

0.9755

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.6%
20x: 98.8%

Validation Efficiency

98% (79/81)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a serine/threonine protein kinase that interacts with protein kinase C-delta. The encoded protein can also activate NFkappaB and is required for keratinocyte differentiation. This kinase undergoes autophosphorylation. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mutations in this gene result in perinatal lethality and epithelial developmental defects. Homozygous mutant lack oral, anal, and nasal openings and display shorter hindlimbs and tail that are partially fused to the body. The skin is significantly thicker with areas of orthokeratosis. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 82 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2210408I21Rik	G	A	13: 77,323,571	V1032M	possibly damaging	Het
Abca13	T	A	11: 9,288,405		probably null	Het
Adamts14	T	A	10: 61,211,596	H739L	possibly damaging	Het
Adgrl3	A	G	5: 81,693,550	E758G	probably damaging	Het
Ano3	T	A	2: 110,665,932	T826S	probably damaging	Het
Arhgap45	C	T	10: 80,025,482	T493I	possibly damaging	Het
Atg9b	A	C	5: 24,388,041	W455G	probably damaging	Het
Atp4a	A	G	7: 30,717,360	N496S	possibly damaging	Het
Bckdk	T	A	7: 127,905,110	D60E	possibly damaging	Het
Blmh	A	T	11: 76,965,899	K244*	probably null	Het
Btbd17	T	C	11: 114,791,465	I474V	possibly damaging	Het
C87436	A	G	6: 86,462,680	E451G	possibly damaging	Het
Camta1	T	C	4: 151,144,737	E546G	probably damaging	Het
Casp1	A	G	9: 5,298,523		probably null	Het
Ccdc114	C	T	7: 45,936,622	R148C	probably damaging	Het
Ccdc116	A	G	16: 17,139,928	Y456H	probably damaging	Het
Cep350	A	C	1: 155,894,707	S1812R	possibly damaging	Het
Chrna10	A	G	7: 102,112,208	L392P	possibly damaging	Het
Col22a1	A	T	15: 71,970,332	C434*	probably null	Het
Cxcl9	G	A	5: 92,323,888	Q98*	probably null	Het
Cyp2c54	G	A	19: 40,046,182	T348I	probably damaging	Het
Dnah7a	G	A	1: 53,618,350	R756C	probably damaging	Het
Dnajc18	T	C	18: 35,681,981	T239A	probably benign	Het
Dnase2a	A	T	8: 84,909,770		probably null	Het
Dpyd	A	G	3: 119,266,032	T793A	probably benign	Het
E430018J23Rik	A	G	7: 127,391,523	S431P	probably benign	Het
Edil3	T	C	13: 88,822,050		probably null	Het
Ehd1	T	A	19: 6,297,642	I342N	possibly damaging	Het
Erbb4	A	T	1: 68,339,460	S341T	probably benign	Het
Ezh1	T	A	11: 101,215,299	T87S	probably benign	Het
Fam20b	A	T	1: 156,690,553	W224R	probably damaging	Het
Galns	A	T	8: 122,599,348		probably null	Het
Gm13283	C	T	4: 88,760,730		probably benign	Het
Gm15448	C	T	7: 3,822,311	C444Y	unknown	Het
Gm49342	A	T	14: 50,944,583	M23L	probably benign	Het
Gm5114	T	A	7: 39,411,371	H18L	probably benign	Het
Gpr89	A	G	3: 96,880,088	W299R	probably damaging	Het
Hadha	G	T	5: 30,119,842	N755K	probably benign	Het
Inpp5d	A	T	1: 87,701,218	H620L	probably benign	Het
Klk1b3	T	A	7: 44,200,404		probably null	Het
Macf1	T	C	4: 123,507,304	T663A	probably damaging	Het
Man1b1	A	G	2: 25,350,390	N601S	probably benign	Het
Mbtps1	A	G	8: 119,524,568	V605A	possibly damaging	Het
Med23	C	G	10: 24,888,429	D311E	probably benign	Het
Myo3a	G	T	2: 22,245,567	D82Y	possibly damaging	Het
Nsd1	T	A	13: 55,247,641	D1121E	probably benign	Het
Olfr1042	C	T	2: 86,159,456	V305I	probably benign	Het
Olfr1221	G	A	2: 89,112,501	Q4*	probably null	Het
Olfr918	A	G	9: 38,673,447	I12T	probably benign	Het
Otoa	T	C	7: 121,118,572	V19A	unknown	Het
Pcdhb20	A	T	18: 37,505,386	T322S	probably benign	Het
Pecam1	T	C	11: 106,695,919	T257A	probably benign	Het
Pi16	G	T	17: 29,319,098		probably benign	Het
Pik3c2g	C	T	6: 139,754,863	T293M		Het
Pkhd1l1	T	A	15: 44,528,163	C1542S	possibly damaging	Het
Prrc2b	G	A	2: 32,229,297	G2172R	probably damaging	Het
Prrt1	A	T	17: 34,629,703		probably null	Het
Ptprb	T	A	10: 116,338,776	N784K	possibly damaging	Het
Rem1	C	A	2: 152,628,149	S18R	probably damaging	Het
Scn8a	G	A	15: 101,029,830	V1397I	possibly damaging	Het
Setbp1	T	A	18: 78,856,837	H1205L	probably damaging	Het
Shmt1	T	C	11: 60,801,535	I132V	probably damaging	Het
Slc24a1	T	A	9: 64,928,503	T781S	unknown	Het
Sncaip	C	T	18: 52,907,343	Q870*	probably null	Het
Stab1	A	T	14: 31,160,797	N416K	possibly damaging	Het
Tcea1	A	G	1: 4,867,483	D26G	probably damaging	Het
Tcf20	A	T	15: 82,853,489	S1254T	probably benign	Het
Tead4	T	A	6: 128,228,678	I354F	probably damaging	Het
Tex36	G	A	7: 133,587,418	R142*	probably null	Het
Trav6d-3	T	A	14: 52,725,342	L12Q	probably damaging	Het
Trpc4	A	G	3: 54,194,896	T72A	possibly damaging	Het
Trrap	G	A	5: 144,797,135	A933T	probably benign	Het
Tspoap1	T	A	11: 87,770,489	I589N	probably benign	Het
Ttll5	T	A	12: 85,933,396	V918E	probably benign	Het
Txn2	A	G	15: 77,927,686		probably null	Het
Ucn3	T	G	13: 3,941,365	T96P	probably benign	Het
Usp36	T	C	11: 118,265,154	E764G	possibly damaging	Het
Vmn2r23	A	T	6: 123,704,364	H77L	probably benign	Het
Vmn2r57	T	C	7: 41,400,286	T680A	probably benign	Het
Vwa3a	T	C	7: 120,795,630	I891T	possibly damaging	Het
Zcchc11	T	C	4: 108,527,008	Y1091H	probably damaging	Het
Zhx2	A	G	15: 57,823,643	I803V	probably benign	Het

Other mutations in Ripk4

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01548:Ripk4	APN	16	97751496	nonsense	probably null
IGL01823:Ripk4	APN	16	97755283	missense	possibly damaging	0.89
IGL01921:Ripk4	APN	16	97743365	missense	possibly damaging	0.62
IGL02023:Ripk4	APN	16	97755231	missense	probably damaging	1.00
IGL02201:Ripk4	APN	16	97755177	missense	possibly damaging	0.91
IGL02709:Ripk4	APN	16	97743566	missense	probably damaging	1.00
G1citation:Ripk4	UTSW	16	97746036	missense	probably damaging	1.00
I2288:Ripk4	UTSW	16	97748145	missense	probably benign	0.16
PIT4495001:Ripk4	UTSW	16	97743170	missense	probably damaging	0.99
R0060:Ripk4	UTSW	16	97763518	splice site	probably benign
R0112:Ripk4	UTSW	16	97743561	missense	probably benign	0.00
R0383:Ripk4	UTSW	16	97748112	missense	probably damaging	1.00
R0524:Ripk4	UTSW	16	97755287	nonsense	probably null
R0540:Ripk4	UTSW	16	97744175	missense	probably damaging	1.00
R0967:Ripk4	UTSW	16	97744172	missense	probably damaging	1.00
R1646:Ripk4	UTSW	16	97743897	missense	probably damaging	1.00
R1785:Ripk4	UTSW	16	97750131	missense	probably damaging	1.00
R2058:Ripk4	UTSW	16	97744142	nonsense	probably null
R2134:Ripk4	UTSW	16	97743733	missense	probably damaging	1.00
R2135:Ripk4	UTSW	16	97743733	missense	probably damaging	1.00
R3410:Ripk4	UTSW	16	97743957	missense	probably benign	0.00
R3411:Ripk4	UTSW	16	97743957	missense	probably benign	0.00
R4538:Ripk4	UTSW	16	97743152	nonsense	probably null
R4627:Ripk4	UTSW	16	97744026	missense	probably damaging	0.99
R4665:Ripk4	UTSW	16	97755073	missense	probably damaging	0.98
R4704:Ripk4	UTSW	16	97746004	nonsense	probably null
R4769:Ripk4	UTSW	16	97744062	missense	probably damaging	1.00
R4860:Ripk4	UTSW	16	97751536	missense	probably damaging	0.97
R4860:Ripk4	UTSW	16	97751536	missense	probably damaging	0.97
R5240:Ripk4	UTSW	16	97743767	missense	probably damaging	1.00
R5864:Ripk4	UTSW	16	97763582	missense	probably damaging	0.98
R6027:Ripk4	UTSW	16	97744074	missense	probably damaging	1.00
R6035:Ripk4	UTSW	16	97744187	missense	probably damaging	1.00
R6035:Ripk4	UTSW	16	97744187	missense	probably damaging	1.00
R6291:Ripk4	UTSW	16	97755123	missense	probably damaging	1.00
R6343:Ripk4	UTSW	16	97763526	critical splice donor site	probably benign
R6572:Ripk4	UTSW	16	97745905	nonsense	probably null
R6783:Ripk4	UTSW	16	97748037	missense	probably damaging	1.00
R6822:Ripk4	UTSW	16	97746036	missense	probably damaging	1.00
R7251:Ripk4	UTSW	16	97743249	missense	probably benign
R7275:Ripk4	UTSW	16	97743957	missense	probably benign	0.00
R7356:Ripk4	UTSW	16	97743149	missense	probably damaging	0.98
R7621:Ripk4	UTSW	16	97745925	missense	probably damaging	1.00
R8065:Ripk4	UTSW	16	97763537	missense	probably damaging	0.97
R8067:Ripk4	UTSW	16	97763537	missense	probably damaging	0.97
R8191:Ripk4	UTSW	16	97763526	critical splice donor site	probably benign
R8742:Ripk4	UTSW	16	97755072	missense	probably damaging	1.00
R8968:Ripk4	UTSW	16	97746003	missense	probably benign	0.38
R9209:Ripk4	UTSW	16	97750111	missense	possibly damaging	0.74
R9513:Ripk4	UTSW	16	97745898	nonsense	probably null
R9784:Ripk4	UTSW	16	97748106	missense	possibly damaging	0.46
Z1176:Ripk4	UTSW	16	97750102	missense	probably damaging	1.00
Z1177:Ripk4	UTSW	16	97755178	missense	probably benign	0.04

Predicted Primers

PCR Primer
(F):5'- AATCTCTAGTGTGCTGAGCAG -3'
(R):5'- GGTATTGAGCATGTCCTCTGC -3'

Sequencing Primer
(F):5'- TGAGCAGATGGGGGTCC -3'
(R):5'- GAGCATGTCCTCTGCTGATC -3'

Posted On

2019-09-06