Incidental Mutation 'R7135:Pdlim5'
ID568678
Institutional Source Beutler Lab
Gene Symbol Pdlim5
Ensembl Gene ENSMUSG00000028273
Gene NamePDZ and LIM domain 5
SynonymsEnh3, Enh, Enh2, 1110001A05Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7135 (G1)
Quality Score225.009
Status Validated
Chromosome3
Chromosomal Location142239590-142395696 bp(-) (GRCm38)
Type of Mutationintron (201 bp from exon)
DNA Base Change (assembly) A to T at 142311922 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000143343 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029941] [ENSMUST00000058626] [ENSMUST00000090134] [ENSMUST00000168967] [ENSMUST00000170361] [ENSMUST00000195975] [ENSMUST00000196220] [ENSMUST00000196908] [ENSMUST00000198381] [ENSMUST00000200043]
Predicted Effect probably null
Transcript: ENSMUST00000029941
SMART Domains Protein: ENSMUSP00000029941
Gene: ENSMUSG00000028273

DomainStartEndE-ValueType
PDZ 12 85 5.54e-17 SMART
low complexity region 144 171 N/A INTRINSIC
Pfam:DUF4749 212 305 1.3e-9 PFAM
low complexity region 310 339 N/A INTRINSIC
LIM 414 465 3.17e-17 SMART
LIM 473 524 4.62e-19 SMART
LIM 532 585 1.79e-16 SMART
Predicted Effect probably null
Transcript: ENSMUST00000058626
SMART Domains Protein: ENSMUSP00000059267
Gene: ENSMUSG00000028273

DomainStartEndE-ValueType
PDZ 12 85 5.54e-17 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000090134
SMART Domains Protein: ENSMUSP00000087595
Gene: ENSMUSG00000028273

DomainStartEndE-ValueType
PDZ 12 85 5.54e-17 SMART
low complexity region 111 118 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000168967
SMART Domains Protein: ENSMUSP00000132647
Gene: ENSMUSG00000028273

DomainStartEndE-ValueType
PDZ 12 85 5.54e-17 SMART
low complexity region 144 171 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000170361
SMART Domains Protein: ENSMUSP00000128752
Gene: ENSMUSG00000028273

DomainStartEndE-ValueType
PDZ 12 85 5.54e-17 SMART
Pfam:DUF4749 101 207 2.7e-10 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000195975
SMART Domains Protein: ENSMUSP00000142737
Gene: ENSMUSG00000028273

DomainStartEndE-ValueType
PDZ 12 85 5.54e-17 SMART
low complexity region 237 246 N/A INTRINSIC
low complexity region 266 283 N/A INTRINSIC
low complexity region 316 331 N/A INTRINSIC
low complexity region 333 362 N/A INTRINSIC
LIM 437 488 3.17e-17 SMART
LIM 496 547 4.62e-19 SMART
LIM 555 608 1.79e-16 SMART
Predicted Effect probably null
Transcript: ENSMUST00000196220
SMART Domains Protein: ENSMUSP00000142460
Gene: ENSMUSG00000028273

DomainStartEndE-ValueType
PDZ 12 85 5.54e-17 SMART
low complexity region 226 243 N/A INTRINSIC
low complexity region 276 291 N/A INTRINSIC
low complexity region 293 322 N/A INTRINSIC
LIM 397 448 3.17e-17 SMART
LIM 456 507 4.62e-19 SMART
LIM 515 568 1.79e-16 SMART
Predicted Effect probably null
Transcript: ENSMUST00000196908
SMART Domains Protein: ENSMUSP00000143098
Gene: ENSMUSG00000028273

DomainStartEndE-ValueType
PDZ 12 85 5.54e-17 SMART
low complexity region 144 171 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000198381
SMART Domains Protein: ENSMUSP00000142899
Gene: ENSMUSG00000028273

DomainStartEndE-ValueType
PDZ 12 85 5.54e-17 SMART
low complexity region 201 230 N/A INTRINSIC
LIM 305 356 3.17e-17 SMART
LIM 364 415 4.62e-19 SMART
LIM 423 476 1.79e-16 SMART
Predicted Effect probably null
Transcript: ENSMUST00000200043
SMART Domains Protein: ENSMUSP00000143343
Gene: ENSMUSG00000028273

DomainStartEndE-ValueType
PDZ 12 85 5.54e-17 SMART
low complexity region 228 243 N/A INTRINSIC
low complexity region 245 274 N/A INTRINSIC
LIM 349 400 3.17e-17 SMART
LIM 408 459 4.62e-19 SMART
LIM 467 520 1.79e-16 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 100% (83/83)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of a family of proteins that possess a 100-amino acid PDZ domain at the N terminus and one to three LIM domains at the C-terminus. This family member functions as a scaffold protein that tethers protein kinases to the Z-disk in striated muscles. It is thought to function in cardiomyocyte expansion and in restraining postsynaptic growth of excitatory synapses. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, Jan 2012]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit impaired cardiac muscle contractility, wider Z-lines, and dilated cardiomyopathy. Mice heterozygous for a gene trap allele exhibit impaired response to methamphetamine. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 86 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700016G14Rik T C 13: 24,741,506 S78P probably benign Het
Aars2 T A 17: 45,508,961 Y221* probably null Het
AC166344.1 T A 14: 43,300,788 F97I Het
Ankmy2 T C 12: 36,196,312 S412P probably benign Het
Ap1s3 T C 1: 79,609,202 T144A probably benign Het
Asb3 T A 11: 30,998,501 L59* probably null Het
Asxl3 G T 18: 22,517,701 G916* probably null Het
Asxl3 G C 18: 22,517,702 G916A probably damaging Het
Birc2 A C 9: 7,818,761 F610V probably damaging Het
Camk4 G A 18: 33,107,943 probably null Het
Ccdc162 A G 10: 41,673,859 S343P probably benign Het
Ccnk T A 12: 108,186,475 L17Q probably damaging Het
Cd59b G A 2: 104,084,447 W63* probably null Het
Chrm3 C T 13: 9,877,801 V400I probably benign Het
Crb1 C A 1: 139,243,367 V762F probably damaging Het
Cspp1 C T 1: 10,088,936 T529I possibly damaging Het
Cttnbp2 A G 6: 18,448,447 I71T possibly damaging Het
Cyb561 C A 11: 105,935,567 G90V probably damaging Het
Cyld T A 8: 88,744,892 D804E possibly damaging Het
Ddx31 G A 2: 28,848,306 V160I probably benign Het
Dgkg T C 16: 22,500,382 D643G probably damaging Het
Dnah12 G A 14: 26,778,912 probably null Het
Dnah12 T G 14: 26,801,413 I1953S probably damaging Het
Dnah7b T C 1: 46,139,710 W848R probably damaging Het
Dnah7c C T 1: 46,533,208 T947M probably damaging Het
Dnmt3c C A 2: 153,714,952 probably null Het
Dsp A T 13: 38,179,073 Y443F probably damaging Het
Espl1 T A 15: 102,319,524 C1603* probably null Het
Faiml G T 9: 99,234,443 R65S probably benign Het
Gfpt2 T C 11: 49,804,955 I4T probably damaging Het
Gm10376 T A 14: 43,010,493 M179L probably benign Het
Gm13084 A T 4: 143,810,663 L366Q probably damaging Het
Gm4302 T A 10: 100,341,727 M291K unknown Het
Gm8906 C T 5: 11,505,231 P83S probably damaging Het
Gnb1l T A 16: 18,545,168 D154E probably benign Het
Igkv10-94 T C 6: 68,704,743 R38G possibly damaging Het
Inmt A T 6: 55,171,028 Y205* probably null Het
Krba1 A G 6: 48,416,299 Q1049R probably benign Het
Lpxn T A 19: 12,833,319 C376S probably damaging Het
Lrrc52 T A 1: 167,466,450 I89F probably damaging Het
Map9 A T 3: 82,363,458 T110S probably benign Het
Mccc1 T C 3: 35,995,818 Y75C probably damaging Het
Mff T A 1: 82,747,091 L203* probably null Het
Micall1 C A 15: 79,109,424 D47E unknown Het
Mink1 T C 11: 70,603,503 F243S probably damaging Het
Mlycd C T 8: 119,402,477 R228W probably damaging Het
Msr1 A T 8: 39,589,424 V370E possibly damaging Het
Naip6 T C 13: 100,300,419 E532G probably damaging Het
Nepn G A 10: 52,391,719 C27Y probably damaging Het
Ninl T C 2: 150,955,604 H592R probably benign Het
Nr4a2 A G 2: 57,112,249 M64T possibly damaging Het
Olfr1279 T A 2: 111,307,020 F272I probably benign Het
Olfr484 T C 7: 108,124,574 K230E probably damaging Het
Oprm1 A T 10: 6,830,203 I171F possibly damaging Het
Pcbp1 A T 6: 86,525,506 M137K possibly damaging Het
Pcf11 A T 7: 92,657,316 S1215T probably benign Het
Pecam1 T C 11: 106,689,031 I402V probably damaging Het
Pex12 T C 11: 83,297,642 T176A probably benign Het
Phf3 T C 1: 30,831,109 K286R possibly damaging Het
Pik3ap1 T A 19: 41,332,321 D153V probably damaging Het
Pkhd1l1 T A 15: 44,584,978 probably null Het
Plekhn1 A G 4: 156,223,335 V378A probably benign Het
Ptprm A T 17: 66,944,288 D531E possibly damaging Het
Pum2 A T 12: 8,728,952 Q508L possibly damaging Het
Rad54l A G 4: 116,105,830 S324P probably damaging Het
Recql5 C T 11: 115,930,672 probably null Het
Reln A T 5: 21,976,596 V1763D possibly damaging Het
Rp1 T C 1: 4,348,168 N907S possibly damaging Het
Scaf11 T A 15: 96,420,328 N452Y possibly damaging Het
Scgb2b3 T A 7: 31,360,214 H45L possibly damaging Het
Sim1 A G 10: 50,895,927 T11A probably damaging Het
Slc5a12 T A 2: 110,616,714 M189K possibly damaging Het
Slco2b1 C T 7: 99,695,063 G10S probably null Het
Stxbp3 A G 3: 108,800,755 L410P probably damaging Het
Sugct T C 13: 17,302,009 N297D probably benign Het
Syne1 A G 10: 5,233,409 I4132T probably benign Het
Teddm1b A T 1: 153,875,166 L240F probably damaging Het
Tlr5 C A 1: 182,975,523 D797E possibly damaging Het
Tmprss13 G T 9: 45,338,345 G327C probably damaging Het
Tnrc18 G T 5: 142,787,817 A419D Het
Ttc28 T C 5: 111,280,007 Y1790H probably damaging Het
Vmn1r125 T G 7: 21,272,402 M75R probably damaging Het
Vwa3a T A 7: 120,773,030 D276E possibly damaging Het
Wdfy3 C T 5: 101,915,437 V1322M probably damaging Het
Wdr11 T C 7: 129,628,106 S872P possibly damaging Het
Zc3h13 T C 14: 75,321,721 S357P unknown Het
Other mutations in Pdlim5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02673:Pdlim5 APN 3 142352787 missense probably damaging 1.00
R1868:Pdlim5 UTSW 3 142306299 critical splice acceptor site probably null
R1937:Pdlim5 UTSW 3 142244981 missense possibly damaging 0.46
R3000:Pdlim5 UTSW 3 142312131 missense probably damaging 1.00
R4477:Pdlim5 UTSW 3 142259217 missense probably benign 0.09
R4959:Pdlim5 UTSW 3 142311979 intron probably benign
R4973:Pdlim5 UTSW 3 142311979 intron probably benign
R5135:Pdlim5 UTSW 3 142304365 missense probably benign 0.34
R5393:Pdlim5 UTSW 3 142259186 missense probably damaging 1.00
R5445:Pdlim5 UTSW 3 142352734 missense probably null 1.00
R5707:Pdlim5 UTSW 3 142304299 missense probably damaging 1.00
R6154:Pdlim5 UTSW 3 142277913 missense possibly damaging 0.68
R6269:Pdlim5 UTSW 3 142312325 missense possibly damaging 0.57
R6395:Pdlim5 UTSW 3 142314422 missense probably damaging 1.00
R6600:Pdlim5 UTSW 3 142259278 missense probably damaging 1.00
R6911:Pdlim5 UTSW 3 142304315 missense probably damaging 0.98
R7283:Pdlim5 UTSW 3 142311980 critical splice acceptor site probably null
R7334:Pdlim5 UTSW 3 142244917 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCTTAAGGAGGTGTAGGCATG -3'
(R):5'- CAGCAAAATGGGTAGGTGGTCC -3'

Sequencing Primer
(F):5'- GTGTAGGCATGCTAAGAACAATTAC -3'
(R):5'- GGGTGATTTCTGTCCTTTTCAAAAC -3'
Posted On2019-09-11