Incidental Mutation 'R7251:Pot1a'
ID 568704
Institutional Source Beutler Lab
Gene Symbol Pot1a
Ensembl Gene ENSMUSG00000029676
Gene Name protection of telomeres 1A
Synonyms 1500031H18Rik, Pot1
MMRRC Submission
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R7251 (G1)
Quality Score 225.009
Status Validated
Chromosome 6
Chromosomal Location 25743737-25809246 bp(-) (GRCm38)
Type of Mutation splice site
DNA Base Change (assembly) T to C at 25752498 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000131928 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000115330] [ENSMUST00000166445]
AlphaFold Q91WC1
Predicted Effect probably null
Transcript: ENSMUST00000115330
SMART Domains Protein: ENSMUSP00000110986
Gene: ENSMUSG00000029676

DomainStartEndE-ValueType
Telo_bind 11 141 3.6e-53 SMART
Pfam:POT1PC 152 299 6.7e-41 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000166445
SMART Domains Protein: ENSMUSP00000131928
Gene: ENSMUSG00000029676

DomainStartEndE-ValueType
Telo_bind 11 141 3.6e-53 SMART
low complexity region 253 260 N/A INTRINSIC
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency 97% (66/68)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the telombin family and encodes a nuclear protein involved in telomere maintenance. Specifically, this protein functions as a member of a multi-protein complex that binds to the TTAGGG repeats of telomeres, regulating telomere length and protecting chromosome ends from illegitimate recombination, catastrophic chromosome instability, and abnormal chromosome segregation. Increased transcriptional expression of this gene is associated with stomach carcinogenesis and its progression. Alternatively spliced transcript variants have been described. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous inactivation of this gene leads to complete prenatal lethality. Embryos homozygous for a gene trapped allele fail to form an inner cell mass in culture. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930480E11Rik G T X: 78,370,705 M345I probably benign Het
Adamts19 A T 18: 58,837,902 D186V probably damaging Het
Agrn T C 4: 156,174,606 D884G probably damaging Het
Akr1c6 T A 13: 4,447,020 C154S probably damaging Het
Apob T C 12: 8,007,037 Y1840H probably damaging Het
Arfgef1 T C 1: 10,198,975 E399G possibly damaging Het
Arg2 G A 12: 79,150,798 G197S probably damaging Het
Arhgap32 T C 9: 32,208,185 V308A probably damaging Het
Atcay A T 10: 81,210,532 C319* probably null Het
Bend4 C G 5: 67,427,533 R16P unknown Het
Braf A G 6: 39,677,570 probably null Het
Camsap1 T C 2: 25,938,886 E942G probably damaging Het
Cdpf1 C T 15: 85,809,293 G11D probably damaging Het
Cgn T C 3: 94,776,199 E382G possibly damaging Het
Cndp1 T A 18: 84,622,197 E294D probably benign Het
Cnn1 T A 9: 22,108,217 Y294N unknown Het
Cyp2ab1 A G 16: 20,315,896 F104S possibly damaging Het
Cyp2t4 G A 7: 27,157,719 V336M possibly damaging Het
D430041D05Rik T A 2: 104,221,166 D782V probably damaging Het
Ddx39b A G 17: 35,253,488 *429W probably null Het
Dgkb T C 12: 37,981,986 S16P possibly damaging Het
Dll4 T C 2: 119,332,292 C465R probably damaging Het
Dsp A G 13: 38,193,548 I1770V probably benign Het
Fbxw11 A G 11: 32,731,370 N250S probably benign Het
Fsip2 G A 2: 82,979,081 V1915M possibly damaging Het
Greb1l G A 18: 10,515,319 V704M probably damaging Het
Hgf T A 5: 16,593,944 N323K possibly damaging Het
Hhatl A T 9: 121,785,050 probably null Het
Hip1r T C 5: 123,994,750 S204P probably damaging Het
Igsf10 T A 3: 59,319,454 N2266I probably damaging Het
Krtap15 A G 16: 88,829,094 probably null Het
Lrp1 T C 10: 127,572,554 D1751G probably damaging Het
Madd A T 2: 91,162,176 D1050E probably benign Het
Man1c1 C T 4: 134,580,836 G323R probably damaging Het
Mgll A G 6: 88,823,375 E252G probably benign Het
Muc2 A G 7: 141,692,722 N145S possibly damaging Het
Ncoa2 C T 1: 13,148,375 S1410N probably benign Het
Nek10 A G 14: 14,853,965 T384A probably benign Het
Nexn T C 3: 152,247,195 E310G probably damaging Het
Nol10 T C 12: 17,402,107 L354P probably damaging Het
Npy4r T C 14: 34,146,915 R139G probably damaging Het
Nup160 A G 2: 90,700,174 E463G probably damaging Het
Olfr1062 G A 2: 86,423,596 L27F probably benign Het
Olfr301 T C 7: 86,413,001 V213A probably benign Het
Olfr622 C T 7: 103,639,702 G146D probably damaging Het
Pdzd8 A T 19: 59,300,645 N774K possibly damaging Het
Pmpca G C 2: 26,395,034 E424Q possibly damaging Het
Ppip5k1 T A 2: 121,347,571 E283D probably benign Het
Ptpn2 A C 18: 67,675,792 I318R possibly damaging Het
Raph1 A G 1: 60,489,868 F745L unknown Het
Rgs19 C T 2: 181,689,748 V88I probably benign Het
Ripk4 A G 16: 97,743,249 S733P probably benign Het
Rprd1b T A 2: 158,028,979 W29R probably damaging Het
Rtkn A G 6: 83,135,962 N5S probably damaging Het
Sh3bp5l A T 11: 58,341,302 Q131L probably damaging Het
Slain2 T A 5: 72,974,548 F461I possibly damaging Het
Stk24 A T 14: 121,308,022 L108Q probably damaging Het
Syne3 TC T 12: 104,961,571 probably null Het
Tapbpl A T 6: 125,226,595 V374E probably damaging Het
Tax1bp1 A G 6: 52,721,356 I18V possibly damaging Het
Tecta T A 9: 42,387,752 I233F probably damaging Het
Tet3 A G 6: 83,404,056 S377P probably benign Het
Uty A G Y: 1,154,262 S721P probably benign Het
Wnk4 C A 11: 101,265,153 T412K possibly damaging Het
Zdhhc11 G T 13: 73,992,097 V336L probably benign Het
Zfp605 T A 5: 110,127,960 S315T probably damaging Het
Zfp746 A G 6: 48,064,877 L305P probably damaging Het
Other mutations in Pot1a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00857:Pot1a APN 6 25744628 missense probably benign 0.01
IGL01393:Pot1a APN 6 25744631 nonsense probably null
IGL01411:Pot1a APN 6 25750144 splice site probably benign
IGL01774:Pot1a APN 6 25753277 missense probably benign 0.00
IGL01981:Pot1a APN 6 25750100 missense probably damaging 1.00
IGL02404:Pot1a APN 6 25764432 splice site probably benign
IGL02530:Pot1a APN 6 25794593 missense probably damaging 1.00
IGL02755:Pot1a APN 6 25771613 missense possibly damaging 0.81
IGL03127:Pot1a APN 6 25794616 missense probably benign 0.00
IGL03396:Pot1a APN 6 25745914 missense possibly damaging 0.93
BB001:Pot1a UTSW 6 25753310 missense possibly damaging 0.94
BB011:Pot1a UTSW 6 25753310 missense possibly damaging 0.94
R0329:Pot1a UTSW 6 25778831 splice site probably benign
R0359:Pot1a UTSW 6 25771680 splice site probably benign
R0530:Pot1a UTSW 6 25771541 missense possibly damaging 0.86
R0840:Pot1a UTSW 6 25748284 splice site probably benign
R0918:Pot1a UTSW 6 25756268 missense possibly damaging 0.92
R1650:Pot1a UTSW 6 25745965 missense probably damaging 1.00
R1937:Pot1a UTSW 6 25753324 missense probably benign 0.15
R2142:Pot1a UTSW 6 25750044 splice site probably null
R4072:Pot1a UTSW 6 25752357 splice site probably null
R4074:Pot1a UTSW 6 25752357 splice site probably null
R4322:Pot1a UTSW 6 25745930 missense probably benign 0.02
R4895:Pot1a UTSW 6 25753206 missense probably damaging 1.00
R4910:Pot1a UTSW 6 25746021 intron probably benign
R4933:Pot1a UTSW 6 25771541 missense possibly damaging 0.86
R5530:Pot1a UTSW 6 25778894 missense probably damaging 1.00
R5748:Pot1a UTSW 6 25758856 missense possibly damaging 0.77
R5775:Pot1a UTSW 6 25757298 splice site probably null
R5870:Pot1a UTSW 6 25778951 missense possibly damaging 0.90
R6180:Pot1a UTSW 6 25771621 missense probably benign 0.00
R6377:Pot1a UTSW 6 25778870 missense probably benign 0.06
R7457:Pot1a UTSW 6 25771622 missense probably benign 0.26
R7679:Pot1a UTSW 6 25771634 missense probably benign 0.16
R7717:Pot1a UTSW 6 25758823 missense probably benign 0.45
R7924:Pot1a UTSW 6 25753310 missense possibly damaging 0.94
R8078:Pot1a UTSW 6 25750108 missense probably benign 0.13
R8084:Pot1a UTSW 6 25771536 missense possibly damaging 0.81
R8170:Pot1a UTSW 6 25758803 makesense probably null
R9070:Pot1a UTSW 6 25744630 missense
R9525:Pot1a UTSW 6 25745917 missense probably benign 0.06
R9574:Pot1a UTSW 6 25775719 missense possibly damaging 0.73
R9638:Pot1a UTSW 6 25750107 nonsense probably null
R9698:Pot1a UTSW 6 25744616 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- GACATAGCTGTAAGCCAAGAGC -3'
(R):5'- GCCTTGGGAAGCCATGATAATG -3'

Sequencing Primer
(F):5'- GCTTGAGCTGACCACATACC -3'
(R):5'- CTCCTGCTGAGTTTAAGTTT -3'
Posted On 2019-09-13