Incidental Mutation 'R7244:Nadk2'
ID568710
Institutional Source Beutler Lab
Gene Symbol Nadk2
Ensembl Gene ENSMUSG00000022253
Gene NameNAD kinase 2, mitochondrial
Synonyms4933430B08Rik, 1110020G09Rik, MNADK, Nadkd1
MMRRC Submission
Accession Numbers

Genbank: NM_001040395; MGI: 1915896

 

Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7244 (G1)
Quality Score201.009
Status Validated
Chromosome15
Chromosomal Location9071260-9110891 bp(+) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) A to G at 9083191 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000098354 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000067760] [ENSMUST00000100789] [ENSMUST00000100790]
Predicted Effect probably null
Transcript: ENSMUST00000067760
SMART Domains Protein: ENSMUSP00000068318
Gene: ENSMUSG00000022253

DomainStartEndE-ValueType
low complexity region 13 33 N/A INTRINSIC
Pfam:NAD_kinase 58 334 4.7e-11 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000100789
SMART Domains Protein: ENSMUSP00000098353
Gene: ENSMUSG00000022253

DomainStartEndE-ValueType
low complexity region 13 33 N/A INTRINSIC
Pfam:NAD_kinase 58 171 8.2e-10 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000100790
SMART Domains Protein: ENSMUSP00000098354
Gene: ENSMUSG00000022253

DomainStartEndE-ValueType
low complexity region 13 33 N/A INTRINSIC
Pfam:NAD_kinase 58 312 3.9e-12 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency 96% (45/47)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a mitochondrial kinase that catalyzes the phosphorylation of NAD to yield NADP. Mutations in this gene result in 2,4-dienoyl-CoA reductase deficiency. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Oct 2014]
PHENOTYPE: Mice homozygous for knock-out allele exhibit increased serum lysine and carnitine levels, develop increased reactive oxygen species levels and hepatic steatosis on an atherogenic high-fat diet, and show impaired fasting-induced fatty acid oxidation. [provided by MGI curators]
Allele List at MGI

All alleles(10) : Gene trapped(10)

Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrb3 A G 1: 25,131,269 F983L probably damaging Het
Cc2d1b T A 4: 108,629,602 M632K probably benign Het
Cdyl2 G A 8: 116,575,260 R461* probably null Het
Cfap57 G A 4: 118,554,800 Q1216* probably null Het
Chd1l A T 3: 97,597,750 V167E probably damaging Het
Col6a1 C A 10: 76,717,408 G391* probably null Het
Ctsc C A 7: 88,302,222 Q226K probably benign Het
Cyp2c54 A G 19: 40,047,509 V319A probably damaging Het
Dnah7b T C 1: 46,277,143 S3139P probably damaging Het
Edrf1 T C 7: 133,654,350 S643P probably benign Het
Fam186a A T 15: 99,946,392 V657D unknown Het
Fkbp11 A G 15: 98,728,192 probably benign Het
Fsip2 G A 2: 82,993,263 A6447T possibly damaging Het
Gm13101 A T 4: 143,965,885 M182K probably benign Het
Gm7030 C A 17: 36,127,604 probably null Het
Hydin A G 8: 110,549,675 D3017G probably damaging Het
Ifi205 G A 1: 174,017,644 Q191* probably null Het
Mbd4 C T 6: 115,844,603 D484N probably benign Het
Med24 C T 11: 98,714,397 probably null Het
Mis18bp1 T C 12: 65,161,630 N103S probably damaging Het
Mmd2 T C 5: 142,564,832 H217R probably damaging Het
Mn1 C T 5: 111,418,833 T223M possibly damaging Het
Ms4a4a A G 19: 11,381,430 Y84C probably damaging Het
Mup5 A T 4: 61,831,581 probably null Het
Mybl2 C T 2: 163,082,685 P658S probably benign Het
Mycbp2 C A 14: 103,208,909 V1828L probably damaging Het
Myh15 T C 16: 49,196,786 Y1887H probably damaging Het
Nsd3 A G 8: 25,666,039 N541D probably damaging Het
Olfr556 G T 7: 102,669,839 probably benign Het
Olfr675 A G 7: 105,024,941 V13A probably benign Het
Oxa1l A T 14: 54,360,855 M1L probably benign Het
Pcdha11 A T 18: 37,011,368 R171* probably null Het
Pkd1l1 A T 11: 8,871,771 V1641E Het
Prom1 T A 5: 44,020,900 I497L probably benign Het
Rasgef1b T C 5: 99,558,894 K41E possibly damaging Het
Rasgrf1 T C 9: 89,994,757 F725S probably damaging Het
Ryr2 T A 13: 11,597,146 S3962C probably damaging Het
Sema5b A T 16: 35,660,545 T829S probably benign Het
Tdp2 A G 13: 24,841,301 D351G probably benign Het
Tet3 A T 6: 83,370,621 D1130E probably damaging Het
Tg T C 15: 66,740,714 C1993R probably damaging Het
Tll1 T C 8: 64,025,188 I844V probably benign Het
Ttll13 A C 7: 80,254,163 K280Q probably damaging Het
Vmn2r109 A G 17: 20,540,683 V804A possibly damaging Het
Vps13c T C 9: 67,889,804 V491A probably benign Het
Xpo5 G T 17: 46,214,625 G233C probably damaging Het
Other mutations in Nadk2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01420:Nadk2 APN 15 9102984 missense probably damaging 1.00
tabak UTSW 15 9108254 missense probably damaging 0.99
PIT4131001:Nadk2 UTSW 15 9100143 frame shift probably null
PIT4142001:Nadk2 UTSW 15 9100143 frame shift probably null
R0347:Nadk2 UTSW 15 9084207 missense probably benign 0.08
R0838:Nadk2 UTSW 15 9091242 missense probably benign 0.00
R0988:Nadk2 UTSW 15 9102992 missense probably damaging 0.99
R1014:Nadk2 UTSW 15 9091254 missense probably damaging 1.00
R1159:Nadk2 UTSW 15 9106837 missense possibly damaging 0.86
R1387:Nadk2 UTSW 15 9106782 missense possibly damaging 0.68
R1861:Nadk2 UTSW 15 9108311 missense probably benign 0.21
R1886:Nadk2 UTSW 15 9103358 missense possibly damaging 0.87
R2354:Nadk2 UTSW 15 9085782 missense probably damaging 1.00
R3623:Nadk2 UTSW 15 9084223 missense probably damaging 1.00
R3624:Nadk2 UTSW 15 9084223 missense probably damaging 1.00
R4642:Nadk2 UTSW 15 9092721 missense possibly damaging 0.64
R4867:Nadk2 UTSW 15 9098857 missense possibly damaging 0.84
R5314:Nadk2 UTSW 15 9108313 missense probably benign 0.04
R7214:Nadk2 UTSW 15 9108254 missense probably damaging 0.99
R7310:Nadk2 UTSW 15 9103381 critical splice donor site probably null
R7634:Nadk2 UTSW 15 9092846 missense probably benign 0.41
R8310:Nadk2 UTSW 15 9103332 missense probably benign
R8424:Nadk2 UTSW 15 9083334 missense possibly damaging 0.92
Predicted Primers PCR Primer
(F):5'- ACGTGTACCCTGGTAAAGGC -3'
(R):5'- TATAAAATCCCCTGTAAGGTCCCATC -3'

Sequencing Primer
(F):5'- CCTGGTAAAGGCATTTAAAAAGCC -3'
(R):5'- ATCGCTTGGACTTACCGTAAAC -3'
Posted On2019-09-13