Incidental Mutation 'R7255:Tcf7l1'
ID 568712
Institutional Source Beutler Lab
Gene Symbol Tcf7l1
Ensembl Gene ENSMUSG00000055799
Gene Name transcription factor 7 like 1 (T cell specific, HMG box)
Synonyms Tcf3
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R7255 (G1)
Quality Score 225.009
Status Validated
Chromosome 6
Chromosomal Location 72626378-72789254 bp(-) (GRCm38)
Type of Mutation splice site
DNA Base Change (assembly) A to T at 72627347 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000109687 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000069536] [ENSMUST00000114053]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000069536
SMART Domains Protein: ENSMUSP00000069403
Gene: ENSMUSG00000055799

DomainStartEndE-ValueType
Pfam:CTNNB1_binding 1 248 1.3e-77 PFAM
HMG 342 412 3.47e-21 SMART
low complexity region 418 426 N/A INTRINSIC
low complexity region 427 438 N/A INTRINSIC
low complexity region 475 494 N/A INTRINSIC
low complexity region 510 530 N/A INTRINSIC
low complexity region 536 545 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000114053
SMART Domains Protein: ENSMUSP00000109687
Gene: ENSMUSG00000055799

DomainStartEndE-ValueType
Pfam:CTNNB1_binding 1 262 6.9e-91 PFAM
HMG 356 426 3.47e-21 SMART
low complexity region 432 440 N/A INTRINSIC
low complexity region 441 452 N/A INTRINSIC
low complexity region 489 508 N/A INTRINSIC
low complexity region 524 544 N/A INTRINSIC
low complexity region 550 559 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.7%
Validation Efficiency 97% (66/68)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the T cell factor/lymphoid enhancer factor family of transcription factors. These transcription factors are activated by beta catenin, mediate the Wnt signaling pathway and are antagonized by the transforming growth factor beta signaling pathway. The encoded protein contains a high mobility group-box DNA binding domain and participates in the regulation of cell cycle genes and cellular senescence. [provided by RefSeq, Nov 2010]
PHENOTYPE: Animals homozygous for a targeted mutation exhibit severe embryological defects particularly affecting the cardiovascular system, nervous system, and digestive system. No homozygous embryos survive beyond E11. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610010F05Rik G A 11: 23,620,465 P145L probably benign Het
9530003J23Rik T C 10: 117,234,422 H150R probably benign Het
Aldh1a7 A G 19: 20,714,728 S234P probably damaging Het
Arhgap28 T C 17: 67,853,004 H650R probably damaging Het
Asic1 A G 15: 99,697,457 D355G probably damaging Het
Atp8b1 T A 18: 64,556,868 S598C probably damaging Het
Bcat1 C A 6: 145,032,785 E237* probably null Het
Btbd16 A T 7: 130,785,992 I114F probably benign Het
Casp2 A G 6: 42,268,907 D166G probably damaging Het
Cd86 CA CAA 16: 36,606,555 probably null Het
Cpsf1 G A 15: 76,597,543 T1099M probably damaging Het
Crisp4 C A 1: 18,130,231 A116S probably damaging Het
Cyb5r3 A G 15: 83,160,165 I168T probably damaging Het
Dip2b G A 15: 100,209,627 D1407N probably benign Het
Dnajc8 A G 4: 132,551,573 K201R probably benign Het
Dock10 C T 1: 80,543,099 probably null Het
Dopey2 C A 16: 93,770,146 H1272N probably damaging Het
Dsc1 C T 18: 20,097,273 R325Q probably benign Het
Enpp1 A T 10: 24,645,315 I838K possibly damaging Het
Fcna T G 2: 25,626,028 D159A probably damaging Het
Flnc G T 6: 29,445,766 G840C probably damaging Het
Flt1 C T 5: 147,580,406 A1024T probably damaging Het
Galc T C 12: 98,246,255 K207R probably null Het
Gbp2b T A 3: 142,608,117 L386Q probably damaging Het
Gm8297 T A 14: 4,984,874 N48K probably damaging Het
Gm9639 G A 10: 77,794,538 P180L unknown Het
Inpp5a A G 7: 139,511,448 N116S probably damaging Het
Ipo9 T C 1: 135,385,988 E984G probably benign Het
Klra4 A G 6: 130,059,642 F145L probably damaging Het
Lag3 A G 6: 124,910,235 L123P probably benign Het
Med7 T A 11: 46,440,995 M139K probably damaging Het
Mfsd2a A C 4: 122,952,021 L153R possibly damaging Het
Mup9 A G 4: 60,421,337 V71A probably benign Het
Myo16 A T 8: 10,499,169 Q927L unknown Het
Myo9b T C 8: 71,290,891 Y199H probably damaging Het
Nefm A G 14: 68,116,000 F406L probably benign Het
Olfr1123 T A 2: 87,418,942 L296Q probably damaging Het
Olfr1333 A T 4: 118,829,952 F162I probably benign Het
Pamr1 T C 2: 102,611,584 F173L probably damaging Het
Pds5b T A 5: 150,796,667 D1205E probably benign Het
Plxna2 T G 1: 194,752,103 F646V probably benign Het
Pnrc1 C T 4: 33,248,045 G118D probably benign Het
Ppp1r16b T C 2: 158,761,391 F412S probably benign Het
Prcc A T 3: 87,870,091 V192E probably damaging Het
Psg19 A G 7: 18,794,048 Y257H probably benign Het
Rfx7 T G 9: 72,619,828 S1433R possibly damaging Het
Rgl2 T C 17: 33,934,990 F457L possibly damaging Het
Sbspon G T 1: 15,883,797 C86* probably null Het
Sdhb A G 4: 140,977,418 E230G possibly damaging Het
Sema6b T C 17: 56,125,336 T581A probably benign Het
Shkbp1 G T 7: 27,342,748 T594K possibly damaging Het
Shpk A G 11: 73,199,660 S48G probably benign Het
Slc1a3 A G 15: 8,642,999 V332A possibly damaging Het
Slc25a25 T C 2: 32,421,372 E135G possibly damaging Het
Slc5a8 A T 10: 88,909,631 D367V probably damaging Het
Slco1c1 A G 6: 141,569,325 T649A probably benign Het
Sorbs1 G C 19: 40,376,800 R180G probably benign Het
Spats1 T A 17: 45,454,205 D163V probably damaging Het
Ssh2 T A 11: 77,425,593 M304K probably damaging Het
Sulf1 T A 1: 12,859,008 D166E probably benign Het
Syne1 A G 10: 5,333,446 S1540P probably damaging Het
Tet1 A T 10: 62,822,636 M1477K probably benign Het
Tlr5 T C 1: 182,974,316 F395S probably damaging Het
Trrap T C 5: 144,858,954 L3847P probably damaging Het
Tsks C T 7: 44,952,688 S276L probably benign Het
Uggt1 T C 1: 36,146,106 E1519G probably damaging Het
Vps13a A G 19: 16,654,339 probably null Het
Wdfy4 A G 14: 32,974,282 V2768A Het
Wdr26 A C 1: 181,181,324 I627R probably benign Het
Zfp160 T A 17: 21,025,487 S100T probably benign Het
Other mutations in Tcf7l1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02517:Tcf7l1 APN 6 72629983 missense probably benign 0.00
IGL03167:Tcf7l1 APN 6 72632996 missense possibly damaging 0.75
R0731:Tcf7l1 UTSW 6 72788269 missense possibly damaging 0.83
R2679:Tcf7l1 UTSW 6 72627420 missense probably benign 0.43
R2887:Tcf7l1 UTSW 6 72632088 missense probably damaging 1.00
R4015:Tcf7l1 UTSW 6 72636399 intron probably benign
R4433:Tcf7l1 UTSW 6 72788769 missense probably damaging 0.96
R4671:Tcf7l1 UTSW 6 72649178 missense probably damaging 0.99
R5262:Tcf7l1 UTSW 6 72636466 intron probably benign
R5891:Tcf7l1 UTSW 6 72637051 intron probably benign
R6767:Tcf7l1 UTSW 6 72631292 missense probably damaging 0.98
R8206:Tcf7l1 UTSW 6 72627412 missense probably damaging 1.00
R8996:Tcf7l1 UTSW 6 72788580 missense possibly damaging 0.69
R9069:Tcf7l1 UTSW 6 72633276 missense probably damaging 1.00
R9193:Tcf7l1 UTSW 6 72634222 missense probably damaging 0.98
R9439:Tcf7l1 UTSW 6 72788757 missense not run
X0027:Tcf7l1 UTSW 6 72788739 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AAAAGCCTGAAGATCAGCTACTG -3'
(R):5'- AAGCCTTGTGATAGCCCTG -3'

Sequencing Primer
(F):5'- GGTTATATCTACAGTGGTAAGGCAC -3'
(R):5'- TGCCTTCCTGTCGGCTAAGG -3'
Posted On 2019-09-13