Incidental Mutation 'R7324:Clca3b'
ID568734
Institutional Source Beutler Lab
Gene Symbol Clca3b
Ensembl Gene ENSMUSG00000037033
Gene Namechloride channel accessory 3B
SynonymsClca4
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.053) question?
Stock #R7324 (G1)
Quality Score225.009
Status Validated
Chromosome3
Chromosomal Location144822623-144849357 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 144841420 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Leucine at position 319 (M319L)
Ref Sequence ENSEMBL: ENSMUSP00000124581 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000159989]
Predicted Effect possibly damaging
Transcript: ENSMUST00000159989
AA Change: M319L

PolyPhen 2 Score 0.814 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000124581
Gene: ENSMUSG00000037033
AA Change: M319L

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
VWA 306 481 6.22e-19 SMART
FN3 762 861 4.93e0 SMART
low complexity region 880 1025 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency 99% (81/82)
Allele List at MGI
Other mutations in this stock
Total: 79 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcg5 T C 17: 84,676,239 D124G possibly damaging Het
Ackr3 C G 1: 90,214,201 N127K probably damaging Het
AL732309.1 A C 2: 25,246,139 M21R possibly damaging Het
Ankrd52 C A 10: 128,386,163 T552K possibly damaging Het
Arhgap28 T C 17: 67,895,884 probably null Het
Arid5b A T 10: 68,128,922 N306K probably benign Het
C1qtnf3 A C 15: 10,952,621 K56N probably benign Het
C2 C T 17: 34,881,688 G52D probably benign Het
Casz1 C T 4: 148,947,033 T1247M probably damaging Het
Cc2d2b A G 19: 40,809,108 D778G unknown Het
Cdh5 A G 8: 104,142,793 D717G probably damaging Het
Clca3a2 G A 3: 144,808,611 A445V probably damaging Het
Csmd1 G A 8: 16,058,707 S1894L probably damaging Het
Csnk1g3 A G 18: 53,919,018 T220A probably damaging Het
Cyp2d10 T G 15: 82,403,760 T381P probably damaging Het
Ddb2 G A 2: 91,236,884 probably benign Het
Ddx24 C A 12: 103,416,259 L688F probably damaging Het
Dennd4c T C 4: 86,829,738 L1615P unknown Het
Dnah8 T A 17: 30,784,125 D3599E probably benign Het
Dst T C 1: 34,006,224 S13P possibly damaging Het
Efcab12 T C 6: 115,823,594 D156G probably benign Het
Enpp2 A G 15: 54,877,774 probably null Het
Ephx2 A G 14: 66,085,354 V490A probably damaging Het
Etnppl A G 3: 130,629,575 N308D probably damaging Het
F5 TCAGAAGACCTCCTCCCCAGACCTGGGCCAGGTGCCCCTTTCTCCAGATGACAACCAGAAGACCTCCTCCCCAGACCTGGGTCAGGTGTCCCTTTCTCCAGATGATAACCAGAAGACCTCCTCCCCAGACCTGGGTCAGGTGCCCCTTTCTCTAGATGACAACCAGAAGACGACCTCCCCAGACCTGGGTCAGGTGCCCCTTTCTCCAGATGACAACCAGA TCAGAAGACCTCCTCCCCAGACCTGGGTCAGGTGTCCCTTTCTCCAGATGATAACCAGAAGACCTCCTCCCCAGACCTGGGTCAGGTGCCCCTTTCTCTAGATGACAACCAGAAGACGACCTCCCCAGACCTGGGTCAGGTGCCCCTTTCTCCAGATGACAACCAGA 1: 164,193,581 probably benign Het
Fam162b A T 10: 51,590,186 probably null Het
Fancl A G 11: 26,403,362 E86G probably damaging Het
Flii G A 11: 60,719,040 T615I probably benign Het
Fndc7 G T 3: 108,872,221 Q336K probably benign Het
Gm14025 T C 2: 129,037,852 D718G unknown Het
Gm26661 T C 14: 7,791,911 C109R unknown Het
H2-DMb1 T C 17: 34,159,462 probably null Het
H2-T10 C T 17: 36,119,297 G251R probably damaging Het
Harbi1 T C 2: 91,720,699 I339T probably benign Het
Hsp90aa1 A G 12: 110,695,225 M119T unknown Het
Ighe T A 12: 113,272,334 Y124F Het
Ighv7-1 T C 12: 113,896,529 Y81C probably damaging Het
Ilkap A T 1: 91,385,393 probably null Het
Inpp5a A G 7: 139,525,670 D179G probably damaging Het
Itgad A T 7: 128,189,807 D510V probably damaging Het
Kcnn2 A T 18: 45,560,071 H238L probably benign Het
Kctd17 T A 15: 78,435,642 C189S probably damaging Het
Larp4b C A 13: 9,158,580 A423E probably benign Het
Llgl2 A G 11: 115,850,730 E562G possibly damaging Het
Macf1 T C 4: 123,374,425 T6734A probably benign Het
Maz G A 7: 127,024,593 T377M probably damaging Het
Mmrn1 G T 6: 60,944,933 G125* probably null Het
Mvp A G 7: 126,993,609 S377P probably benign Het
Nin C T 12: 70,043,734 R969Q Het
Nktr T A 9: 121,748,291 M475K possibly damaging Het
Nktr C T 9: 121,727,361 T35I probably damaging Het
Nod2 T A 8: 88,653,066 V65D probably damaging Het
Olfr1249 A T 2: 89,630,103 I265N possibly damaging Het
Olfr135 T C 17: 38,208,716 V157A probably benign Het
Olfr1487 A G 19: 13,619,578 I96V probably benign Het
Olfr1493-ps1 C T 19: 13,726,906 A215V probably benign Het
Olfr203 T C 16: 59,303,248 F32L probably benign Het
Olfr398 A G 11: 73,983,843 V255A probably benign Het
Olfr794 T A 10: 129,570,849 S65T probably damaging Het
Olfr868 A T 9: 20,101,430 I224F possibly damaging Het
Opa1 A T 16: 29,586,981 E121D probably benign Het
Osbpl2 A G 2: 180,150,201 T233A probably benign Het
Pcp4l1 G A 1: 171,174,465 A42V possibly damaging Het
Plekhh3 T A 11: 101,170,774 D38V possibly damaging Het
Prtg C T 9: 72,890,840 A696V probably damaging Het
Ptpn14 T G 1: 189,863,424 V748G possibly damaging Het
Reg2 A T 6: 78,406,154 D28V probably benign Het
Rhpn1 A T 15: 75,704,397 I2F possibly damaging Het
Rundc3a A G 11: 102,399,973 E294G possibly damaging Het
Scara3 T A 14: 65,931,416 I251L probably benign Het
Slc23a2 G A 2: 132,089,123 T152I probably damaging Het
Slc39a2 T G 14: 51,894,193 S74A possibly damaging Het
Tmprss15 T C 16: 78,962,019 Y937C probably damaging Het
Tpp2 T C 1: 43,978,778 L779S probably damaging Het
Tssk2 T C 16: 17,899,363 V210A possibly damaging Het
Ttn T A 2: 76,895,593 T6100S unknown Het
Tufm G A 7: 126,489,587 E317K possibly damaging Het
Wdfy4 A G 14: 33,047,314 S2219P Het
Wtap T C 17: 12,980,946 N50S possibly damaging Het
Other mutations in Clca3b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00090:Clca3b APN 3 144836632 missense probably damaging 0.96
IGL00425:Clca3b APN 3 144836581 missense probably benign 0.14
IGL00725:Clca3b APN 3 144839162 missense probably benign 0.01
IGL00898:Clca3b APN 3 144844628 splice site probably benign
IGL00953:Clca3b APN 3 144847211 nonsense probably null
IGL01089:Clca3b APN 3 144823522 missense probably benign
IGL01376:Clca3b APN 3 144826051 missense possibly damaging 0.60
IGL01996:Clca3b APN 3 144849163 missense probably benign 0.04
IGL02022:Clca3b APN 3 144841410 critical splice donor site probably null
IGL02200:Clca3b APN 3 144841429 missense probably damaging 1.00
IGL02314:Clca3b APN 3 144828142 splice site probably benign
IGL02331:Clca3b APN 3 144841406 splice site probably benign
IGL02429:Clca3b APN 3 144828135 missense probably damaging 1.00
IGL02868:Clca3b APN 3 144827564 missense probably damaging 1.00
IGL03095:Clca3b APN 3 144846910 nonsense probably null
IGL03331:Clca3b APN 3 144827963 missense probably benign
R0242:Clca3b UTSW 3 144841465 missense probably benign 0.00
R0242:Clca3b UTSW 3 144841465 missense probably benign 0.00
R0506:Clca3b UTSW 3 144822866 unclassified probably benign
R0524:Clca3b UTSW 3 144825321 missense probably benign
R0637:Clca3b UTSW 3 144827940 missense probably benign 0.03
R1577:Clca3b UTSW 3 144823519 missense probably damaging 1.00
R1641:Clca3b UTSW 3 144823513 missense possibly damaging 0.53
R1680:Clca3b UTSW 3 144837824 missense probably damaging 1.00
R2240:Clca3b UTSW 3 144825935 missense probably benign 0.22
R2248:Clca3b UTSW 3 144825219 missense probably benign 0.01
R2259:Clca3b UTSW 3 144846381 missense possibly damaging 0.80
R2920:Clca3b UTSW 3 144837853 missense probably benign 0.31
R2920:Clca3b UTSW 3 144846931 missense probably benign 0.01
R4355:Clca3b UTSW 3 144825458 splice site probably null
R4691:Clca3b UTSW 3 144839092 missense probably benign 0.02
R4828:Clca3b UTSW 3 144844512 missense probably benign 0.02
R4845:Clca3b UTSW 3 144825270 missense probably benign
R5182:Clca3b UTSW 3 144828015 missense probably damaging 0.99
R5396:Clca3b UTSW 3 144847171 missense probably damaging 0.99
R5429:Clca3b UTSW 3 144846459 missense probably damaging 1.00
R5572:Clca3b UTSW 3 144827309 missense probably damaging 1.00
R5657:Clca3b UTSW 3 144827383 missense probably benign 0.25
R5845:Clca3b UTSW 3 144825316 missense possibly damaging 0.46
R6505:Clca3b UTSW 3 144825259 missense probably benign 0.18
R6677:Clca3b UTSW 3 144823384 missense probably benign 0.13
R6707:Clca3b UTSW 3 144844527 missense probably benign 0.00
R7001:Clca3b UTSW 3 144827972 missense possibly damaging 0.48
R7285:Clca3b UTSW 3 144837758 missense probably benign 0.00
R7323:Clca3b UTSW 3 144825920 missense possibly damaging 0.60
R7334:Clca3b UTSW 3 144836656 nonsense probably null
R7403:Clca3b UTSW 3 144823498 missense probably benign 0.00
R7798:Clca3b UTSW 3 144828130 missense probably damaging 1.00
R8008:Clca3b UTSW 3 144844609 missense probably benign 0.44
R8132:Clca3b UTSW 3 144847174 missense probably benign 0.13
R8181:Clca3b UTSW 3 144839137 missense probably benign 0.00
R8305:Clca3b UTSW 3 144825937 missense probably damaging 1.00
R8546:Clca3b UTSW 3 144827397 missense probably damaging 0.99
R8716:Clca3b UTSW 3 144844594 missense probably benign 0.14
R8804:Clca3b UTSW 3 144839137 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- ATGTGATATGTTCAATGGTGGTACC -3'
(R):5'- AGGTGGTTGAATTCTGCACAG -3'

Sequencing Primer
(F):5'- CAGGCTGGCTTAAAACTAATGCTC -3'
(R):5'- CAATGTAGAAGCTCCAAACCTAC -3'
Posted On2019-09-13