Incidental Mutation 'R7324:Arid5b'
ID 568753
Institutional Source Beutler Lab
Gene Symbol Arid5b
Ensembl Gene ENSMUSG00000019947
Gene Name AT-rich interaction domain 5B
Synonyms Mrf2alpha, Mrf2beta, Mrf2, 5430435G07Rik, Desrt
MMRRC Submission 045418-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.941) question?
Stock # R7324 (G1)
Quality Score 225.009
Status Validated
Chromosome 10
Chromosomal Location 67928350-68114570 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 67964752 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Asparagine to Lysine at position 306 (N306K)
Ref Sequence ENSEMBL: ENSMUSP00000151227 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020106] [ENSMUST00000218532] [ENSMUST00000219238]
AlphaFold Q8BM75
Predicted Effect probably benign
Transcript: ENSMUST00000020106
SMART Domains Protein: ENSMUSP00000020106
Gene: ENSMUSG00000019947

DomainStartEndE-ValueType
ARID 316 407 8.29e-35 SMART
BRIGHT 320 412 4.18e-38 SMART
low complexity region 425 438 N/A INTRINSIC
low complexity region 451 462 N/A INTRINSIC
low complexity region 538 549 N/A INTRINSIC
low complexity region 695 718 N/A INTRINSIC
low complexity region 730 741 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000218532
AA Change: N63K

PolyPhen 2 Score 0.007 (Sensitivity: 0.96; Specificity: 0.75)
Predicted Effect probably benign
Transcript: ENSMUST00000219238
AA Change: N306K

PolyPhen 2 Score 0.444 (Sensitivity: 0.89; Specificity: 0.90)
Meta Mutation Damage Score 0.0893 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency 99% (81/82)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the AT-rich interaction domain (ARID) family of DNA binding proteins. The encoded protein forms a histone H3K9Me2 demethylase complex with PHD finger protein 2 and regulates the transcription of target genes involved in adipogenesis and liver development. This gene also plays a role in cell growth and differentiation of B-lymphocyte progenitors, and single nucleotide polymorphisms in this gene are associated with acute lymphoblastic leukemia. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Sep 2011]
PHENOTYPE: Mice homozygous for disruptions in this gene experience a high level of mortality perinatally or earlier. Growth rates are low and mice remain small throughout live. There are abnormalities in various organ systems as well as the reproductive system. Fertility is reduced. [provided by MGI curators]
Allele List at MGI

All alleles(212) : Targeted, knock-out(2) Gene trapped(210)

Other mutations in this stock
Total: 79 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcg5 T C 17: 84,983,667 (GRCm39) D124G possibly damaging Het
Ackr3 C G 1: 90,141,923 (GRCm39) N127K probably damaging Het
AL732309.1 A C 2: 25,136,151 (GRCm39) M21R possibly damaging Het
Ankrd52 C A 10: 128,222,032 (GRCm39) T552K possibly damaging Het
Arhgap28 T C 17: 68,202,879 (GRCm39) probably null Het
C1qtnf3 A C 15: 10,952,707 (GRCm39) K56N probably benign Het
C2 C T 17: 35,100,664 (GRCm39) G52D probably benign Het
Casz1 C T 4: 149,031,490 (GRCm39) T1247M probably damaging Het
Cc2d2b A G 19: 40,797,552 (GRCm39) D778G unknown Het
Cdh5 A G 8: 104,869,425 (GRCm39) D717G probably damaging Het
Clca3a2 G A 3: 144,514,372 (GRCm39) A445V probably damaging Het
Clca3b T A 3: 144,547,181 (GRCm39) M319L possibly damaging Het
Csmd1 G A 8: 16,108,721 (GRCm39) S1894L probably damaging Het
Csnk1g3 A G 18: 54,052,090 (GRCm39) T220A probably damaging Het
Cyp2d10 T G 15: 82,287,961 (GRCm39) T381P probably damaging Het
Ddb2 G A 2: 91,067,229 (GRCm39) probably benign Het
Ddx24 C A 12: 103,382,518 (GRCm39) L688F probably damaging Het
Dennd4c T C 4: 86,747,975 (GRCm39) L1615P unknown Het
Dnah8 T A 17: 31,003,099 (GRCm39) D3599E probably benign Het
Dst T C 1: 34,045,305 (GRCm39) S13P possibly damaging Het
Efcab12 T C 6: 115,800,555 (GRCm39) D156G probably benign Het
Enpp2 A G 15: 54,741,170 (GRCm39) probably null Het
Ephx2 A G 14: 66,322,803 (GRCm39) V490A probably damaging Het
Etnppl A G 3: 130,423,224 (GRCm39) N308D probably damaging Het
F5 TCAGAAGACCTCCTCCCCAGACCTGGGCCAGGTGCCCCTTTCTCCAGATGACAACCAGAAGACCTCCTCCCCAGACCTGGGTCAGGTGTCCCTTTCTCCAGATGATAACCAGAAGACCTCCTCCCCAGACCTGGGTCAGGTGCCCCTTTCTCTAGATGACAACCAGAAGACGACCTCCCCAGACCTGGGTCAGGTGCCCCTTTCTCCAGATGACAACCAGA TCAGAAGACCTCCTCCCCAGACCTGGGTCAGGTGTCCCTTTCTCCAGATGATAACCAGAAGACCTCCTCCCCAGACCTGGGTCAGGTGCCCCTTTCTCTAGATGACAACCAGAAGACGACCTCCCCAGACCTGGGTCAGGTGCCCCTTTCTCCAGATGACAACCAGA 1: 164,021,150 (GRCm39) probably benign Het
Fam162b A T 10: 51,466,282 (GRCm39) probably null Het
Fancl A G 11: 26,353,362 (GRCm39) E86G probably damaging Het
Flii G A 11: 60,609,866 (GRCm39) T615I probably benign Het
Fndc7 G T 3: 108,779,537 (GRCm39) Q336K probably benign Het
Gm26661 T C 14: 7,791,911 (GRCm38) C109R unknown Het
H2-DMb1 T C 17: 34,378,436 (GRCm39) probably null Het
H2-T10 C T 17: 36,430,189 (GRCm39) G251R probably damaging Het
Harbi1 T C 2: 91,551,044 (GRCm39) I339T probably benign Het
Hsp90aa1 A G 12: 110,661,659 (GRCm39) M119T unknown Het
Ighe T A 12: 113,235,954 (GRCm39) Y124F Het
Ighv7-1 T C 12: 113,860,149 (GRCm39) Y81C probably damaging Het
Ilkap A T 1: 91,313,115 (GRCm39) probably null Het
Inpp5a A G 7: 139,105,586 (GRCm39) D179G probably damaging Het
Itgad A T 7: 127,788,979 (GRCm39) D510V probably damaging Het
Kcnn2 A T 18: 45,693,138 (GRCm39) H238L probably benign Het
Kctd17 T A 15: 78,319,842 (GRCm39) C189S probably damaging Het
Larp4b C A 13: 9,208,616 (GRCm39) A423E probably benign Het
Llgl2 A G 11: 115,741,556 (GRCm39) E562G possibly damaging Het
Macf1 T C 4: 123,268,218 (GRCm39) T6734A probably benign Het
Maz G A 7: 126,623,765 (GRCm39) T377M probably damaging Het
Mmrn1 G T 6: 60,921,917 (GRCm39) G125* probably null Het
Mvp A G 7: 126,592,781 (GRCm39) S377P probably benign Het
Nin C T 12: 70,090,508 (GRCm39) R969Q Het
Nktr C T 9: 121,556,427 (GRCm39) T35I probably damaging Het
Nktr T A 9: 121,577,357 (GRCm39) M475K possibly damaging Het
Nod2 T A 8: 89,379,694 (GRCm39) V65D probably damaging Het
Opa1 A T 16: 29,405,799 (GRCm39) E121D probably benign Het
Or10w3 C T 19: 13,704,270 (GRCm39) A215V probably benign Het
Or1r1 A G 11: 73,874,669 (GRCm39) V255A probably benign Het
Or2n1c T C 17: 38,519,607 (GRCm39) V157A probably benign Het
Or4a76 A T 2: 89,460,447 (GRCm39) I265N possibly damaging Het
Or5ac21 T C 16: 59,123,611 (GRCm39) F32L probably benign Het
Or5b123 A G 19: 13,596,942 (GRCm39) I96V probably benign Het
Or6c88 T A 10: 129,406,718 (GRCm39) S65T probably damaging Het
Or7e174 A T 9: 20,012,726 (GRCm39) I224F possibly damaging Het
Osbpl2 A G 2: 179,791,994 (GRCm39) T233A probably benign Het
Pcp4l1 G A 1: 171,002,034 (GRCm39) A42V possibly damaging Het
Plekhh3 T A 11: 101,061,600 (GRCm39) D38V possibly damaging Het
Prtg C T 9: 72,798,122 (GRCm39) A696V probably damaging Het
Ptpn14 T G 1: 189,595,621 (GRCm39) V748G possibly damaging Het
Reg2 A T 6: 78,383,137 (GRCm39) D28V probably benign Het
Rhpn1 A T 15: 75,576,246 (GRCm39) I2F possibly damaging Het
Rundc3a A G 11: 102,290,799 (GRCm39) E294G possibly damaging Het
Scara3 T A 14: 66,168,865 (GRCm39) I251L probably benign Het
Slc23a2 G A 2: 131,931,043 (GRCm39) T152I probably damaging Het
Slc39a2 T G 14: 52,131,650 (GRCm39) S74A possibly damaging Het
Tmprss15 T C 16: 78,758,907 (GRCm39) Y937C probably damaging Het
Tpp2 T C 1: 44,017,938 (GRCm39) L779S probably damaging Het
Tssk2 T C 16: 17,717,227 (GRCm39) V210A possibly damaging Het
Ttn T A 2: 76,725,937 (GRCm39) T6100S unknown Het
Tufm G A 7: 126,088,759 (GRCm39) E317K possibly damaging Het
Vinac1 T C 2: 128,879,772 (GRCm39) D718G unknown Het
Wdfy4 A G 14: 32,769,271 (GRCm39) S2219P Het
Wtap T C 17: 13,199,833 (GRCm39) N50S possibly damaging Het
Other mutations in Arid5b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00229:Arid5b APN 10 67,964,805 (GRCm39) missense probably damaging 0.96
IGL01731:Arid5b APN 10 67,933,439 (GRCm39) missense probably damaging 1.00
IGL02069:Arid5b APN 10 67,933,229 (GRCm39) missense probably damaging 1.00
IGL02161:Arid5b APN 10 67,932,498 (GRCm39) missense probably benign 0.00
IGL02555:Arid5b APN 10 67,937,734 (GRCm39) missense probably benign 0.01
IGL02873:Arid5b APN 10 67,937,780 (GRCm39) missense probably benign 0.06
IGL03119:Arid5b APN 10 68,079,057 (GRCm39) missense probably damaging 1.00
IGL03271:Arid5b APN 10 67,933,287 (GRCm39) missense possibly damaging 0.73
gobi UTSW 10 67,954,175 (GRCm39) missense possibly damaging 0.92
3-1:Arid5b UTSW 10 67,934,419 (GRCm39) missense probably damaging 1.00
PIT4677001:Arid5b UTSW 10 67,933,841 (GRCm39) missense probably damaging 0.99
R0108:Arid5b UTSW 10 68,114,559 (GRCm39) utr 5 prime probably benign
R0525:Arid5b UTSW 10 67,933,676 (GRCm39) missense possibly damaging 0.90
R0533:Arid5b UTSW 10 68,021,863 (GRCm39) missense probably damaging 1.00
R0646:Arid5b UTSW 10 67,932,807 (GRCm39) missense probably damaging 1.00
R1066:Arid5b UTSW 10 67,934,186 (GRCm39) missense probably benign 0.04
R1487:Arid5b UTSW 10 67,933,044 (GRCm39) nonsense probably null
R1638:Arid5b UTSW 10 68,113,777 (GRCm39) missense possibly damaging 0.48
R1789:Arid5b UTSW 10 68,021,897 (GRCm39) missense probably damaging 0.99
R2031:Arid5b UTSW 10 68,114,518 (GRCm39) critical splice donor site probably null
R2337:Arid5b UTSW 10 67,933,607 (GRCm39) missense possibly damaging 0.63
R2996:Arid5b UTSW 10 67,934,292 (GRCm39) missense probably benign 0.01
R2997:Arid5b UTSW 10 67,934,292 (GRCm39) missense probably benign 0.01
R3547:Arid5b UTSW 10 67,934,292 (GRCm39) missense probably benign 0.01
R4411:Arid5b UTSW 10 67,932,519 (GRCm39) missense probably damaging 1.00
R4860:Arid5b UTSW 10 68,078,925 (GRCm39) missense probably damaging 0.97
R4860:Arid5b UTSW 10 68,078,925 (GRCm39) missense probably damaging 0.97
R5219:Arid5b UTSW 10 68,113,940 (GRCm39) missense probably benign 0.08
R5341:Arid5b UTSW 10 68,113,957 (GRCm39) missense possibly damaging 0.87
R5434:Arid5b UTSW 10 67,932,719 (GRCm39) missense possibly damaging 0.67
R5757:Arid5b UTSW 10 67,937,909 (GRCm39) missense probably damaging 1.00
R6114:Arid5b UTSW 10 67,933,574 (GRCm39) missense possibly damaging 0.89
R6313:Arid5b UTSW 10 67,933,412 (GRCm39) missense possibly damaging 0.95
R6338:Arid5b UTSW 10 67,934,391 (GRCm39) nonsense probably null
R6525:Arid5b UTSW 10 67,933,496 (GRCm39) missense possibly damaging 0.47
R6915:Arid5b UTSW 10 68,022,042 (GRCm39) nonsense probably null
R7013:Arid5b UTSW 10 67,933,649 (GRCm39) missense probably damaging 1.00
R7099:Arid5b UTSW 10 67,934,009 (GRCm39) missense probably damaging 1.00
R7260:Arid5b UTSW 10 67,933,637 (GRCm39) missense probably damaging 1.00
R7334:Arid5b UTSW 10 68,079,007 (GRCm39) missense possibly damaging 0.61
R7432:Arid5b UTSW 10 67,954,096 (GRCm39) missense probably damaging 1.00
R7453:Arid5b UTSW 10 68,078,994 (GRCm39) missense probably benign 0.01
R7649:Arid5b UTSW 10 67,954,175 (GRCm39) missense possibly damaging 0.92
R7659:Arid5b UTSW 10 67,934,417 (GRCm39) missense probably benign
R7661:Arid5b UTSW 10 67,934,417 (GRCm39) missense probably benign
R7662:Arid5b UTSW 10 67,934,417 (GRCm39) missense probably benign
R7663:Arid5b UTSW 10 67,934,417 (GRCm39) missense probably benign
R7665:Arid5b UTSW 10 67,934,417 (GRCm39) missense probably benign
R7666:Arid5b UTSW 10 67,934,417 (GRCm39) missense probably benign
R7759:Arid5b UTSW 10 67,933,632 (GRCm39) missense probably damaging 1.00
R7779:Arid5b UTSW 10 67,932,606 (GRCm39) missense probably damaging 1.00
R7788:Arid5b UTSW 10 67,934,417 (GRCm39) missense probably benign
R7789:Arid5b UTSW 10 67,934,417 (GRCm39) missense probably benign
R7875:Arid5b UTSW 10 67,964,771 (GRCm39) missense probably benign 0.02
R8079:Arid5b UTSW 10 67,934,186 (GRCm39) missense possibly damaging 0.88
R8096:Arid5b UTSW 10 68,021,982 (GRCm39) missense probably benign 0.00
R8228:Arid5b UTSW 10 68,114,536 (GRCm39) missense possibly damaging 0.95
R8377:Arid5b UTSW 10 67,933,217 (GRCm39) missense probably damaging 0.96
R8757:Arid5b UTSW 10 67,933,640 (GRCm39) missense probably damaging 1.00
R8910:Arid5b UTSW 10 67,934,108 (GRCm39) missense
R8954:Arid5b UTSW 10 67,937,810 (GRCm39) missense possibly damaging 0.88
R9234:Arid5b UTSW 10 67,964,628 (GRCm39) missense possibly damaging 0.82
R9272:Arid5b UTSW 10 67,937,882 (GRCm39) missense probably damaging 0.99
R9430:Arid5b UTSW 10 68,022,087 (GRCm39) critical splice acceptor site probably null
X0066:Arid5b UTSW 10 67,954,132 (GRCm39) missense probably damaging 1.00
Z1177:Arid5b UTSW 10 67,933,058 (GRCm39) missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- CGCCGCCTTGCAATTTCAAAG -3'
(R):5'- CTTTGTTGCCATCGTCTAGAAG -3'

Sequencing Primer
(F):5'- CGCCTTGCAATTTCAAAGAATCTTAG -3'
(R):5'- GTCTAGAAGCATCCTCACTCAAGGG -3'
Posted On 2019-09-13