Mutagenetix > Incidental Mutation

Incidental Mutation 'R7324:Nin'

568762

Institutional Source

Beutler Lab

Gene Symbol

Nin

Ensembl Gene

ENSMUSG00000021068

Gene Name

ninein

Synonyms

3110068G20Rik

MMRRC Submission

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R7324 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

70011435-70113717 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 70043734 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Arginine to Glutamine at position 969 (R969Q)

Ref Sequence

ENSEMBL: ENSMUSP00000082422 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000021468] [ENSMUST00000085314] [ENSMUST00000095666] [ENSMUST00000169074] [ENSMUST00000220689] [ENSMUST00000222237] [ENSMUST00000222835] [ENSMUST00000223257]

AlphaFold

Q61043

Predicted Effect

probably benign
Transcript: ENSMUST00000021468
AA Change: R969Q

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000021468
Gene: ENSMUSG00000021068
AA Change: R969Q

Domain	Start	End	E-Value	Type
internal_repeat_1	7	67	7.83e-8	PROSPERO
low complexity region	97	108	N/A	INTRINSIC
low complexity region	115	132	N/A	INTRINSIC
internal_repeat_1	181	242	7.83e-8	PROSPERO
low complexity region	276	289	N/A	INTRINSIC
low complexity region	336	353	N/A	INTRINSIC
coiled coil region	358	570	N/A	INTRINSIC
coiled coil region	625	802	N/A	INTRINSIC
coiled coil region	834	926	N/A	INTRINSIC
coiled coil region	957	1008	N/A	INTRINSIC
low complexity region	1035	1044	N/A	INTRINSIC
low complexity region	1047	1057	N/A	INTRINSIC
coiled coil region	1069	1094	N/A	INTRINSIC
coiled coil region	1178	1325	N/A	INTRINSIC
low complexity region	1374	1385	N/A	INTRINSIC
coiled coil region	1425	1806	N/A	INTRINSIC
coiled coil region	1980	2013	N/A	INTRINSIC

Predicted Effect

SMART Domains

Protein: ENSMUSP00000082422
Gene: ENSMUSG00000021068
AA Change: R969Q

Domain	Start	End	E-Value	Type
internal_repeat_1	7	67	4.15e-8	PROSPERO
low complexity region	97	108	N/A	INTRINSIC
low complexity region	115	132	N/A	INTRINSIC
internal_repeat_1	181	242	4.15e-8	PROSPERO
low complexity region	276	289	N/A	INTRINSIC
low complexity region	336	353	N/A	INTRINSIC
coiled coil region	358	570	N/A	INTRINSIC
coiled coil region	625	802	N/A	INTRINSIC
coiled coil region	834	926	N/A	INTRINSIC
coiled coil region	957	1008	N/A	INTRINSIC
low complexity region	1035	1044	N/A	INTRINSIC
low complexity region	1047	1057	N/A	INTRINSIC
coiled coil region	1069	1094	N/A	INTRINSIC
coiled coil region	1178	1325	N/A	INTRINSIC
low complexity region	1374	1385	N/A	INTRINSIC
coiled coil region	1425	1806	N/A	INTRINSIC
coiled coil region	1971	2045	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000095666
AA Change: R969Q

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000093327
Gene: ENSMUSG00000021068
AA Change: R969Q

Domain	Start	End	E-Value	Type
internal_repeat_1	7	67	7.83e-8	PROSPERO
low complexity region	97	108	N/A	INTRINSIC
low complexity region	115	132	N/A	INTRINSIC
internal_repeat_1	181	242	7.83e-8	PROSPERO
low complexity region	276	289	N/A	INTRINSIC
low complexity region	336	353	N/A	INTRINSIC
coiled coil region	358	570	N/A	INTRINSIC
coiled coil region	625	802	N/A	INTRINSIC
coiled coil region	834	926	N/A	INTRINSIC
coiled coil region	957	1008	N/A	INTRINSIC
low complexity region	1035	1044	N/A	INTRINSIC
low complexity region	1047	1057	N/A	INTRINSIC
coiled coil region	1069	1094	N/A	INTRINSIC
coiled coil region	1178	1325	N/A	INTRINSIC
low complexity region	1374	1385	N/A	INTRINSIC
coiled coil region	1425	1806	N/A	INTRINSIC
coiled coil region	1980	2013	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000169074
AA Change: R969Q

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000129648
Gene: ENSMUSG00000021068
AA Change: R969Q

Domain	Start	End	E-Value	Type
internal_repeat_1	7	67	7.83e-8	PROSPERO
low complexity region	97	108	N/A	INTRINSIC
low complexity region	115	132	N/A	INTRINSIC
internal_repeat_1	181	242	7.83e-8	PROSPERO
low complexity region	276	289	N/A	INTRINSIC
low complexity region	336	353	N/A	INTRINSIC
coiled coil region	358	570	N/A	INTRINSIC
coiled coil region	625	802	N/A	INTRINSIC
coiled coil region	834	926	N/A	INTRINSIC
coiled coil region	957	1008	N/A	INTRINSIC
low complexity region	1035	1044	N/A	INTRINSIC
low complexity region	1047	1057	N/A	INTRINSIC
coiled coil region	1069	1094	N/A	INTRINSIC
coiled coil region	1178	1325	N/A	INTRINSIC
low complexity region	1374	1385	N/A	INTRINSIC
coiled coil region	1425	1806	N/A	INTRINSIC
coiled coil region	1980	2013	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000220689

Predicted Effect

probably benign
Transcript: ENSMUST00000222835

Predicted Effect

probably benign
Transcript: ENSMUST00000223257
AA Change: R969Q

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.7%
20x: 98.9%

Validation Efficiency

99% (81/82)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes one of the proteins important for centrosomal function. This protein is important for positioning and anchoring the microtubules minus-ends in epithelial cells. Localization of this protein to the centrosome requires three leucine zippers in the central coiled-coil domain. Multiple alternatively spliced transcript variants that encode different isoforms have been reported. [provided by RefSeq, Jul 2008]

Allele List at MGI

Other mutations in this stock

Total: 79 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abcg5	T	C	17: 84,676,239	D124G	possibly damaging	Het
Ackr3	C	G	1: 90,214,201	N127K	probably damaging	Het
AL732309.1	A	C	2: 25,246,139	M21R	possibly damaging	Het
Ankrd52	C	A	10: 128,386,163	T552K	possibly damaging	Het
Arhgap28	T	C	17: 67,895,884		probably null	Het
Arid5b	A	T	10: 68,128,922	N306K	probably benign	Het
C1qtnf3	A	C	15: 10,952,621	K56N	probably benign	Het
C2	C	T	17: 34,881,688	G52D	probably benign	Het
Casz1	C	T	4: 148,947,033	T1247M	probably damaging	Het
Cc2d2b	A	G	19: 40,809,108	D778G	unknown	Het
Cdh5	A	G	8: 104,142,793	D717G	probably damaging	Het
Clca3a2	G	A	3: 144,808,611	A445V	probably damaging	Het
Clca3b	T	A	3: 144,841,420	M319L	possibly damaging	Het
Csmd1	G	A	8: 16,058,707	S1894L	probably damaging	Het
Csnk1g3	A	G	18: 53,919,018	T220A	probably damaging	Het
Cyp2d10	T	G	15: 82,403,760	T381P	probably damaging	Het
Ddb2	G	A	2: 91,236,884		probably benign	Het
Ddx24	C	A	12: 103,416,259	L688F	probably damaging	Het
Dennd4c	T	C	4: 86,829,738	L1615P	unknown	Het
Dnah8	T	A	17: 30,784,125	D3599E	probably benign	Het
Dst	T	C	1: 34,006,224	S13P	possibly damaging	Het
Efcab12	T	C	6: 115,823,594	D156G	probably benign	Het
Enpp2	A	G	15: 54,877,774		probably null	Het
Ephx2	A	G	14: 66,085,354	V490A	probably damaging	Het
Etnppl	A	G	3: 130,629,575	N308D	probably damaging	Het
F5	TCAGAAGACCTCCTCCCCAGACCTGGGCCAGGTGCCCCTTTCTCCAGATGACAACCAGAAGACCTCCTCCCCAGACCTGGGTCAGGTGTCCCTTTCTCCAGATGATAACCAGAAGACCTCCTCCCCAGACCTGGGTCAGGTGCCCCTTTCTCTAGATGACAACCAGAAGACGACCTCCCCAGACCTGGGTCAGGTGCCCCTTTCTCCAGATGACAACCAGA	TCAGAAGACCTCCTCCCCAGACCTGGGTCAGGTGTCCCTTTCTCCAGATGATAACCAGAAGACCTCCTCCCCAGACCTGGGTCAGGTGCCCCTTTCTCTAGATGACAACCAGAAGACGACCTCCCCAGACCTGGGTCAGGTGCCCCTTTCTCCAGATGACAACCAGA	1: 164,193,581		probably benign	Het
Fam162b	A	T	10: 51,590,186		probably null	Het
Fancl	A	G	11: 26,403,362	E86G	probably damaging	Het
Flii	G	A	11: 60,719,040	T615I	probably benign	Het
Fndc7	G	T	3: 108,872,221	Q336K	probably benign	Het
Gm14025	T	C	2: 129,037,852	D718G	unknown	Het
Gm26661	T	C	14: 7,791,911	C109R	unknown	Het
H2-DMb1	T	C	17: 34,159,462		probably null	Het
H2-T10	C	T	17: 36,119,297	G251R	probably damaging	Het
Harbi1	T	C	2: 91,720,699	I339T	probably benign	Het
Hsp90aa1	A	G	12: 110,695,225	M119T	unknown	Het
Ighe	T	A	12: 113,272,334	Y124F		Het
Ighv7-1	T	C	12: 113,896,529	Y81C	probably damaging	Het
Ilkap	A	T	1: 91,385,393		probably null	Het
Inpp5a	A	G	7: 139,525,670	D179G	probably damaging	Het
Itgad	A	T	7: 128,189,807	D510V	probably damaging	Het
Kcnn2	A	T	18: 45,560,071	H238L	probably benign	Het
Kctd17	T	A	15: 78,435,642	C189S	probably damaging	Het
Larp4b	C	A	13: 9,158,580	A423E	probably benign	Het
Llgl2	A	G	11: 115,850,730	E562G	possibly damaging	Het
Macf1	T	C	4: 123,374,425	T6734A	probably benign	Het
Maz	G	A	7: 127,024,593	T377M	probably damaging	Het
Mmrn1	G	T	6: 60,944,933	G125*	probably null	Het
Mvp	A	G	7: 126,993,609	S377P	probably benign	Het
Nktr	C	T	9: 121,727,361	T35I	probably damaging	Het
Nktr	T	A	9: 121,748,291	M475K	possibly damaging	Het
Nod2	T	A	8: 88,653,066	V65D	probably damaging	Het
Olfr1249	A	T	2: 89,630,103	I265N	possibly damaging	Het
Olfr135	T	C	17: 38,208,716	V157A	probably benign	Het
Olfr1487	A	G	19: 13,619,578	I96V	probably benign	Het
Olfr1493-ps1	C	T	19: 13,726,906	A215V	probably benign	Het
Olfr203	T	C	16: 59,303,248	F32L	probably benign	Het
Olfr398	A	G	11: 73,983,843	V255A	probably benign	Het
Olfr794	T	A	10: 129,570,849	S65T	probably damaging	Het
Olfr868	A	T	9: 20,101,430	I224F	possibly damaging	Het
Opa1	A	T	16: 29,586,981	E121D	probably benign	Het
Osbpl2	A	G	2: 180,150,201	T233A	probably benign	Het
Pcp4l1	G	A	1: 171,174,465	A42V	possibly damaging	Het
Plekhh3	T	A	11: 101,170,774	D38V	possibly damaging	Het
Prtg	C	T	9: 72,890,840	A696V	probably damaging	Het
Ptpn14	T	G	1: 189,863,424	V748G	possibly damaging	Het
Reg2	A	T	6: 78,406,154	D28V	probably benign	Het
Rhpn1	A	T	15: 75,704,397	I2F	possibly damaging	Het
Rundc3a	A	G	11: 102,399,973	E294G	possibly damaging	Het
Scara3	T	A	14: 65,931,416	I251L	probably benign	Het
Slc23a2	G	A	2: 132,089,123	T152I	probably damaging	Het
Slc39a2	T	G	14: 51,894,193	S74A	possibly damaging	Het
Tmprss15	T	C	16: 78,962,019	Y937C	probably damaging	Het
Tpp2	T	C	1: 43,978,778	L779S	probably damaging	Het
Tssk2	T	C	16: 17,899,363	V210A	possibly damaging	Het
Ttn	T	A	2: 76,895,593	T6100S	unknown	Het
Tufm	G	A	7: 126,489,587	E317K	possibly damaging	Het
Wdfy4	A	G	14: 33,047,314	S2219P		Het
Wtap	T	C	17: 12,980,946	N50S	possibly damaging	Het

Other mutations in Nin

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00472:Nin	APN	12	70030088	missense	probably damaging	0.98
IGL00677:Nin	APN	12	70026860	missense	probably damaging	1.00
IGL00823:Nin	APN	12	70014793	missense	probably benign	0.01
IGL01103:Nin	APN	12	70056758	missense	probably damaging	0.99
IGL01113:Nin	APN	12	70031779	missense	probably damaging	1.00
IGL01420:Nin	APN	12	70045414	missense	probably benign	0.08
IGL01556:Nin	APN	12	70043188	missense	probably benign	0.01
IGL01663:Nin	APN	12	70043665	missense	possibly damaging	0.72
IGL02002:Nin	APN	12	70062699	nonsense	probably null
IGL02030:Nin	APN	12	70045268	missense	probably damaging	1.00
IGL02202:Nin	APN	12	70055436	missense	probably damaging	1.00
IGL02207:Nin	APN	12	70056657	missense	probably damaging	0.99
IGL02257:Nin	APN	12	70102691	missense	possibly damaging	0.71
IGL02394:Nin	APN	12	70044031	missense	probably damaging	1.00
IGL02531:Nin	APN	12	70020932	missense	probably benign	0.02
IGL03028:Nin	APN	12	70035270	missense	probably benign	0.13
IGL03155:Nin	APN	12	70031770	missense	probably damaging	1.00
IGL03197:Nin	APN	12	70026810	missense	probably benign	0.03
IGL02835:Nin	UTSW	12	70056738	missense	probably damaging	1.00
R0131:Nin	UTSW	12	70051141	missense	probably damaging	1.00
R0131:Nin	UTSW	12	70051141	missense	probably damaging	1.00
R0132:Nin	UTSW	12	70051141	missense	probably damaging	1.00
R0211:Nin	UTSW	12	70014875	missense	probably damaging	1.00
R0211:Nin	UTSW	12	70014875	missense	probably damaging	1.00
R0734:Nin	UTSW	12	70030113	missense	probably benign	0.01
R0947:Nin	UTSW	12	70061186	missense	probably damaging	1.00
R1085:Nin	UTSW	12	70020962	missense	possibly damaging	0.91
R1367:Nin	UTSW	12	70043929	missense	probably damaging	0.99
R1452:Nin	UTSW	12	70017650	nonsense	probably null
R1477:Nin	UTSW	12	70044184	missense	possibly damaging	0.87
R1518:Nin	UTSW	12	70014773	missense	probably benign	0.27
R1566:Nin	UTSW	12	70054479	missense	probably damaging	0.99
R1572:Nin	UTSW	12	70038750	missense	probably damaging	1.00
R1583:Nin	UTSW	12	70031738	missense	probably benign
R1584:Nin	UTSW	12	70042669	missense	probably benign	0.03
R1699:Nin	UTSW	12	70030938	missense	probably benign	0.40
R1699:Nin	UTSW	12	70045563	missense	possibly damaging	0.87
R1765:Nin	UTSW	12	70042891	missense	probably damaging	1.00
R1794:Nin	UTSW	12	70043795	nonsense	probably null
R1952:Nin	UTSW	12	70030926	missense	probably damaging	1.00
R2004:Nin	UTSW	12	70025477	missense	probably benign	0.01
R2025:Nin	UTSW	12	70030008	missense	probably damaging	1.00
R2060:Nin	UTSW	12	70042418	missense	possibly damaging	0.64
R2213:Nin	UTSW	12	70045354	missense	probably damaging	1.00
R2224:Nin	UTSW	12	70061230	missense	probably damaging	1.00
R2247:Nin	UTSW	12	70054545	missense	probably damaging	1.00
R2972:Nin	UTSW	12	70062713	missense	probably damaging	1.00
R3776:Nin	UTSW	12	70038682	missense	possibly damaging	0.71
R3881:Nin	UTSW	12	70042541	missense	probably benign	0.00
R3930:Nin	UTSW	12	70078242	missense	probably damaging	1.00
R3959:Nin	UTSW	12	70050752	missense	probably damaging	1.00
R4229:Nin	UTSW	12	70051210	missense	probably damaging	0.99
R4359:Nin	UTSW	12	70014938	missense	probably benign	0.00
R4423:Nin	UTSW	12	70042978	missense	probably damaging	1.00
R4461:Nin	UTSW	12	70042585	missense	probably benign	0.37
R4639:Nin	UTSW	12	70038601	missense	probably damaging	0.97
R4791:Nin	UTSW	12	70043807	missense	possibly damaging	0.94
R4839:Nin	UTSW	12	70090551	missense	possibly damaging	0.46
R4912:Nin	UTSW	12	70044063	missense	probably damaging	1.00
R5712:Nin	UTSW	12	70042769	missense	probably damaging	1.00
R5726:Nin	UTSW	12	70078179	missense	probably damaging	1.00
R5804:Nin	UTSW	12	70045601	missense	possibly damaging	0.58
R5874:Nin	UTSW	12	70030918	missense	possibly damaging	0.94
R5992:Nin	UTSW	12	70045524	missense	possibly damaging	0.83
R6077:Nin	UTSW	12	70019232	missense	probably damaging	1.00
R6184:Nin	UTSW	12	70043737	missense	probably damaging	1.00
R6307:Nin	UTSW	12	70014857	missense	possibly damaging	0.91
R6315:Nin	UTSW	12	70045615	missense	probably damaging	1.00
R6326:Nin	UTSW	12	70045181	missense	possibly damaging	0.95
R6492:Nin	UTSW	12	70054534	missense	probably benign	0.22
R6562:Nin	UTSW	12	70055954	missense	probably damaging	1.00
R6578:Nin	UTSW	12	70061194	missense	probably damaging	0.99
R6613:Nin	UTSW	12	70030954	missense	probably damaging	1.00
R7112:Nin	UTSW	12	70102799	missense
R7170:Nin	UTSW	12	70044239	missense
R7338:Nin	UTSW	12	70044064	missense
R7372:Nin	UTSW	12	70056029	missense
R7431:Nin	UTSW	12	70078223	missense
R7577:Nin	UTSW	12	70062706	missense
R7655:Nin	UTSW	12	70042768	missense
R7656:Nin	UTSW	12	70042768	missense
R7683:Nin	UTSW	12	70078182	missense
R7769:Nin	UTSW	12	70043230	missense
R7981:Nin	UTSW	12	70042817	missense
R8138:Nin	UTSW	12	70042898	missense
R8141:Nin	UTSW	12	70030021	missense
R8754:Nin	UTSW	12	70031013	intron	probably benign
R8790:Nin	UTSW	12	70021019	missense
R8899:Nin	UTSW	12	70030936	missense	probably damaging	1.00
R8974:Nin	UTSW	12	70078158	missense
R9085:Nin	UTSW	12	70030012	nonsense	probably null
R9143:Nin	UTSW	12	70090575	missense
R9380:Nin	UTSW	12	70028031	missense
R9496:Nin	UTSW	12	70055988	missense
R9638:Nin	UTSW	12	70020844	missense
R9709:Nin	UTSW	12	70102694	missense
R9745:Nin	UTSW	12	70043125	missense
R9792:Nin	UTSW	12	70047235	missense
Z1176:Nin	UTSW	12	70049164	critical splice acceptor site	probably null
Z1177:Nin	UTSW	12	70044095	missense
Z1177:Nin	UTSW	12	70054426	missense

Predicted Primers

PCR Primer
(F):5'- AATAGCTGCTCGCCTTGCTG -3'
(R):5'- TGCTGCAAGACCTGAAAGACC -3'

Sequencing Primer
(F):5'- AAGCAGGGACATGGCTCCATC -3'
(R):5'- TGCAAGACCTGAAAGACCTACAG -3'

Posted On

2019-09-13