Mutagenetix > Incidental Mutation

Incidental Mutation 'R7324:Hsp90aa1'

568764

Institutional Source

Beutler Lab

Gene Symbol

Hsp90aa1

Ensembl Gene

ENSMUSG00000021270

Gene Name

heat shock protein 90, alpha (cytosolic), class A member 1

Synonyms

hsp4, Hspca, Hsp90, Hsp86-1, Hsp89

MMRRC Submission

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R7324 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

110690605-110702728 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 110695225 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Methionine to Threonine at position 119 (M119T)

Ref Sequence

ENSEMBL: ENSMUSP00000091921 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000021698] [ENSMUST00000094361] [ENSMUST00000124156] [ENSMUST00000149189] [ENSMUST00000155242]

AlphaFold

P07901

Predicted Effect

unknown
Transcript: ENSMUST00000021698
AA Change: M119T

SMART Domains

Protein: ENSMUSP00000021698
Gene: ENSMUSG00000021270
AA Change: M119T

Domain	Start	End	E-Value	Type
HATPase_c	40	194	2.94e-11	SMART
Pfam:HSP90	196	733	6.7e-272	PFAM

Predicted Effect

unknown
Transcript: ENSMUST00000094361
AA Change: M119T

SMART Domains

Protein: ENSMUSP00000091921
Gene: ENSMUSG00000021270
AA Change: M119T

Domain	Start	End	E-Value	Type
HATPase_c	40	194	2.94e-11	SMART
Pfam:HSP90	196	728	2e-245	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000124156

SMART Domains

Protein: ENSMUSP00000121138
Gene: ENSMUSG00000021270

Domain	Start	End	E-Value	Type
PDB:3HHU\|B	1	103	1e-69	PDB
SCOP:d1byqa_	11	103	5e-48	SMART
Blast:HATPase_c	40	103	7e-39	BLAST

Predicted Effect

probably benign
Transcript: ENSMUST00000149189

SMART Domains

Protein: ENSMUSP00000114201
Gene: ENSMUSG00000021270

Domain	Start	End	E-Value	Type
PDB:3HHU\|B	1	98	6e-66	PDB
SCOP:d1byqa_	11	98	2e-45	SMART
Blast:HATPase_c	40	98	2e-35	BLAST

Predicted Effect

unknown
Transcript: ENSMUST00000155242
AA Change: M119T

SMART Domains

Protein: ENSMUSP00000118189
Gene: ENSMUSG00000021270
AA Change: M119T

Domain	Start	End	E-Value	Type
HATPase_c	40	194	2.94e-11	SMART

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.7%
20x: 98.9%

Validation Efficiency

99% (81/82)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is an inducible molecular chaperone that functions as a homodimer. The encoded protein aids in the proper folding of specific target proteins by use of an ATPase activity that is modulated by co-chaperones. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jan 2012]
PHENOTYPE: Mice homozygous for a gene trap allele exhibit male sterility associated with arrested male meiosis and male germ cell apoptosis. Mice homozygous for a transgenic gene disruption exhibit male sterility and small testis. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 79 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abcg5	T	C	17: 84,676,239	D124G	possibly damaging	Het
Ackr3	C	G	1: 90,214,201	N127K	probably damaging	Het
AL732309.1	A	C	2: 25,246,139	M21R	possibly damaging	Het
Ankrd52	C	A	10: 128,386,163	T552K	possibly damaging	Het
Arhgap28	T	C	17: 67,895,884		probably null	Het
Arid5b	A	T	10: 68,128,922	N306K	probably benign	Het
C1qtnf3	A	C	15: 10,952,621	K56N	probably benign	Het
C2	C	T	17: 34,881,688	G52D	probably benign	Het
Casz1	C	T	4: 148,947,033	T1247M	probably damaging	Het
Cc2d2b	A	G	19: 40,809,108	D778G	unknown	Het
Cdh5	A	G	8: 104,142,793	D717G	probably damaging	Het
Clca3a2	G	A	3: 144,808,611	A445V	probably damaging	Het
Clca3b	T	A	3: 144,841,420	M319L	possibly damaging	Het
Csmd1	G	A	8: 16,058,707	S1894L	probably damaging	Het
Csnk1g3	A	G	18: 53,919,018	T220A	probably damaging	Het
Cyp2d10	T	G	15: 82,403,760	T381P	probably damaging	Het
Ddb2	G	A	2: 91,236,884		probably benign	Het
Ddx24	C	A	12: 103,416,259	L688F	probably damaging	Het
Dennd4c	T	C	4: 86,829,738	L1615P	unknown	Het
Dnah8	T	A	17: 30,784,125	D3599E	probably benign	Het
Dst	T	C	1: 34,006,224	S13P	possibly damaging	Het
Efcab12	T	C	6: 115,823,594	D156G	probably benign	Het
Enpp2	A	G	15: 54,877,774		probably null	Het
Ephx2	A	G	14: 66,085,354	V490A	probably damaging	Het
Etnppl	A	G	3: 130,629,575	N308D	probably damaging	Het
F5	TCAGAAGACCTCCTCCCCAGACCTGGGCCAGGTGCCCCTTTCTCCAGATGACAACCAGAAGACCTCCTCCCCAGACCTGGGTCAGGTGTCCCTTTCTCCAGATGATAACCAGAAGACCTCCTCCCCAGACCTGGGTCAGGTGCCCCTTTCTCTAGATGACAACCAGAAGACGACCTCCCCAGACCTGGGTCAGGTGCCCCTTTCTCCAGATGACAACCAGA	TCAGAAGACCTCCTCCCCAGACCTGGGTCAGGTGTCCCTTTCTCCAGATGATAACCAGAAGACCTCCTCCCCAGACCTGGGTCAGGTGCCCCTTTCTCTAGATGACAACCAGAAGACGACCTCCCCAGACCTGGGTCAGGTGCCCCTTTCTCCAGATGACAACCAGA	1: 164,193,581		probably benign	Het
Fam162b	A	T	10: 51,590,186		probably null	Het
Fancl	A	G	11: 26,403,362	E86G	probably damaging	Het
Flii	G	A	11: 60,719,040	T615I	probably benign	Het
Fndc7	G	T	3: 108,872,221	Q336K	probably benign	Het
Gm14025	T	C	2: 129,037,852	D718G	unknown	Het
Gm26661	T	C	14: 7,791,911	C109R	unknown	Het
H2-DMb1	T	C	17: 34,159,462		probably null	Het
H2-T10	C	T	17: 36,119,297	G251R	probably damaging	Het
Harbi1	T	C	2: 91,720,699	I339T	probably benign	Het
Ighe	T	A	12: 113,272,334	Y124F		Het
Ighv7-1	T	C	12: 113,896,529	Y81C	probably damaging	Het
Ilkap	A	T	1: 91,385,393		probably null	Het
Inpp5a	A	G	7: 139,525,670	D179G	probably damaging	Het
Itgad	A	T	7: 128,189,807	D510V	probably damaging	Het
Kcnn2	A	T	18: 45,560,071	H238L	probably benign	Het
Kctd17	T	A	15: 78,435,642	C189S	probably damaging	Het
Larp4b	C	A	13: 9,158,580	A423E	probably benign	Het
Llgl2	A	G	11: 115,850,730	E562G	possibly damaging	Het
Macf1	T	C	4: 123,374,425	T6734A	probably benign	Het
Maz	G	A	7: 127,024,593	T377M	probably damaging	Het
Mmrn1	G	T	6: 60,944,933	G125*	probably null	Het
Mvp	A	G	7: 126,993,609	S377P	probably benign	Het
Nin	C	T	12: 70,043,734	R969Q		Het
Nktr	C	T	9: 121,727,361	T35I	probably damaging	Het
Nktr	T	A	9: 121,748,291	M475K	possibly damaging	Het
Nod2	T	A	8: 88,653,066	V65D	probably damaging	Het
Olfr1249	A	T	2: 89,630,103	I265N	possibly damaging	Het
Olfr135	T	C	17: 38,208,716	V157A	probably benign	Het
Olfr1487	A	G	19: 13,619,578	I96V	probably benign	Het
Olfr1493-ps1	C	T	19: 13,726,906	A215V	probably benign	Het
Olfr203	T	C	16: 59,303,248	F32L	probably benign	Het
Olfr398	A	G	11: 73,983,843	V255A	probably benign	Het
Olfr794	T	A	10: 129,570,849	S65T	probably damaging	Het
Olfr868	A	T	9: 20,101,430	I224F	possibly damaging	Het
Opa1	A	T	16: 29,586,981	E121D	probably benign	Het
Osbpl2	A	G	2: 180,150,201	T233A	probably benign	Het
Pcp4l1	G	A	1: 171,174,465	A42V	possibly damaging	Het
Plekhh3	T	A	11: 101,170,774	D38V	possibly damaging	Het
Prtg	C	T	9: 72,890,840	A696V	probably damaging	Het
Ptpn14	T	G	1: 189,863,424	V748G	possibly damaging	Het
Reg2	A	T	6: 78,406,154	D28V	probably benign	Het
Rhpn1	A	T	15: 75,704,397	I2F	possibly damaging	Het
Rundc3a	A	G	11: 102,399,973	E294G	possibly damaging	Het
Scara3	T	A	14: 65,931,416	I251L	probably benign	Het
Slc23a2	G	A	2: 132,089,123	T152I	probably damaging	Het
Slc39a2	T	G	14: 51,894,193	S74A	possibly damaging	Het
Tmprss15	T	C	16: 78,962,019	Y937C	probably damaging	Het
Tpp2	T	C	1: 43,978,778	L779S	probably damaging	Het
Tssk2	T	C	16: 17,899,363	V210A	possibly damaging	Het
Ttn	T	A	2: 76,895,593	T6100S	unknown	Het
Tufm	G	A	7: 126,489,587	E317K	possibly damaging	Het
Wdfy4	A	G	14: 33,047,314	S2219P		Het
Wtap	T	C	17: 12,980,946	N50S	possibly damaging	Het

Other mutations in Hsp90aa1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL02056:Hsp90aa1	APN	12	110694015	unclassified	probably benign
IGL02243:Hsp90aa1	APN	12	110695091	missense	probably damaging	1.00
IGL02865:Hsp90aa1	APN	12	110693082	missense	probably benign	0.11
IGL02965:Hsp90aa1	APN	12	110695679	start codon destroyed	probably null	0.95
R0827:Hsp90aa1	UTSW	12	110692695	missense	probably benign	0.38
R1331:Hsp90aa1	UTSW	12	110692820	missense	probably damaging	1.00
R1498:Hsp90aa1	UTSW	12	110695688	splice site	probably null
R2039:Hsp90aa1	UTSW	12	110693782	missense	probably damaging	1.00
R2082:Hsp90aa1	UTSW	12	110692827	missense	probably damaging	1.00
R2102:Hsp90aa1	UTSW	12	110694132	missense	probably damaging	0.99
R2169:Hsp90aa1	UTSW	12	110692734	missense	probably damaging	0.99
R2194:Hsp90aa1	UTSW	12	110695680	start codon destroyed	possibly damaging	0.59
R2194:Hsp90aa1	UTSW	12	110695681	critical splice acceptor site	probably null
R2359:Hsp90aa1	UTSW	12	110694569	critical splice donor site	probably null
R2364:Hsp90aa1	UTSW	12	110692753	missense	probably damaging	0.99
R2393:Hsp90aa1	UTSW	12	110693406	missense	probably damaging	1.00
R2398:Hsp90aa1	UTSW	12	110692321	missense	possibly damaging	0.86
R2435:Hsp90aa1	UTSW	12	110695680	start codon destroyed	possibly damaging	0.59
R2435:Hsp90aa1	UTSW	12	110695681	critical splice acceptor site	probably null
R2924:Hsp90aa1	UTSW	12	110695680	start codon destroyed	possibly damaging	0.59
R2924:Hsp90aa1	UTSW	12	110695681	critical splice acceptor site	probably null
R2925:Hsp90aa1	UTSW	12	110695680	start codon destroyed	possibly damaging	0.59
R2925:Hsp90aa1	UTSW	12	110695681	critical splice acceptor site	probably null
R3176:Hsp90aa1	UTSW	12	110695680	start codon destroyed	possibly damaging	0.59
R3176:Hsp90aa1	UTSW	12	110695681	critical splice acceptor site	probably null
R3177:Hsp90aa1	UTSW	12	110695680	start codon destroyed	possibly damaging	0.59
R3177:Hsp90aa1	UTSW	12	110695681	critical splice acceptor site	probably null
R3276:Hsp90aa1	UTSW	12	110695680	start codon destroyed	possibly damaging	0.59
R3276:Hsp90aa1	UTSW	12	110695681	critical splice acceptor site	probably null
R3277:Hsp90aa1	UTSW	12	110695680	start codon destroyed	possibly damaging	0.59
R3277:Hsp90aa1	UTSW	12	110695681	critical splice acceptor site	probably null
R3615:Hsp90aa1	UTSW	12	110695680	start codon destroyed	possibly damaging	0.59
R3615:Hsp90aa1	UTSW	12	110695681	critical splice acceptor site	probably null
R3616:Hsp90aa1	UTSW	12	110695680	start codon destroyed	possibly damaging	0.59
R3616:Hsp90aa1	UTSW	12	110695681	critical splice acceptor site	probably null
R4033:Hsp90aa1	UTSW	12	110695680	start codon destroyed	possibly damaging	0.59
R4033:Hsp90aa1	UTSW	12	110695681	critical splice acceptor site	probably null
R4815:Hsp90aa1	UTSW	12	110695226	missense	possibly damaging	0.45
R4932:Hsp90aa1	UTSW	12	110693717	missense	probably damaging	1.00
R5117:Hsp90aa1	UTSW	12	110695264	missense	possibly damaging	0.71
R5555:Hsp90aa1	UTSW	12	110692734	missense	probably damaging	1.00
R6382:Hsp90aa1	UTSW	12	110695517	critical splice donor site	probably null
R7024:Hsp90aa1	UTSW	12	110694112	missense	possibly damaging	0.46
R7447:Hsp90aa1	UTSW	12	110692128	missense	possibly damaging	0.94
R7526:Hsp90aa1	UTSW	12	110695294	missense	unknown
R7732:Hsp90aa1	UTSW	12	110693418	missense	probably damaging	1.00
R8155:Hsp90aa1	UTSW	12	110695394	missense	unknown
R9004:Hsp90aa1	UTSW	12	110692611	missense	probably damaging	0.99
R9145:Hsp90aa1	UTSW	12	110696250	critical splice donor site	probably null
Z1177:Hsp90aa1	UTSW	12	110693466	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- GCACTTACTGAAGTTAACCAGAC -3'
(R):5'- ATCCGTTACGAGAGCCTGAC -3'

Sequencing Primer
(F):5'- GCCTATGCCTACCTGTGTCAG -3'
(R):5'- TGACGGACCCCAGTAAACTG -3'

Posted On

2019-09-13