Incidental Mutation 'R7324:Wdfy4'
ID568769
Institutional Source Beutler Lab
Gene Symbol Wdfy4
Ensembl Gene ENSMUSG00000051506
Gene NameWD repeat and FYVE domain containing 4
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7324 (G1)
Quality Score200.009
Status Validated
Chromosome14
Chromosomal Location32959547-33185508 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 33047314 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 2219 (S2219P)
Ref Sequence ENSEMBL: ENSMUSP00000117068 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000061753] [ENSMUST00000130509]
Predicted Effect probably benign
Transcript: ENSMUST00000061753
AA Change: S2065P

PolyPhen 2 Score 0.231 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000057556
Gene: ENSMUSG00000051506
AA Change: S2065P

DomainStartEndE-ValueType
low complexity region 69 77 N/A INTRINSIC
low complexity region 204 222 N/A INTRINSIC
low complexity region 508 522 N/A INTRINSIC
low complexity region 618 632 N/A INTRINSIC
low complexity region 644 661 N/A INTRINSIC
low complexity region 1585 1604 N/A INTRINSIC
low complexity region 1899 1909 N/A INTRINSIC
Pfam:PH_BEACH 2237 2348 1.2e-9 PFAM
Beach 2378 2660 3.69e-196 SMART
WD40 2761 2801 1.98e1 SMART
WD40 2811 2850 5.18e-7 SMART
WD40 2853 2891 9.94e-1 SMART
WD40 2893 2940 3.17e-2 SMART
WD40 2986 3021 3.31e0 SMART
Predicted Effect
SMART Domains Protein: ENSMUSP00000117068
Gene: ENSMUSG00000051506
AA Change: S2219P

DomainStartEndE-ValueType
low complexity region 69 77 N/A INTRINSIC
low complexity region 204 222 N/A INTRINSIC
low complexity region 508 522 N/A INTRINSIC
low complexity region 618 632 N/A INTRINSIC
low complexity region 644 661 N/A INTRINSIC
low complexity region 1596 1615 N/A INTRINSIC
low complexity region 1795 1819 N/A INTRINSIC
low complexity region 2019 2029 N/A INTRINSIC
Pfam:PH_BEACH 2362 2473 1.2e-9 PFAM
Beach 2503 2785 3.69e-196 SMART
WD40 2886 2926 1.98e1 SMART
WD40 2936 2975 5.18e-7 SMART
WD40 2978 3016 9.94e-1 SMART
WD40 3018 3065 3.17e-2 SMART
WD40 3111 3146 3.31e0 SMART
Meta Mutation Damage Score 0.2213 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency 99% (81/82)
Allele List at MGI
Other mutations in this stock
Total: 79 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcg5 T C 17: 84,676,239 D124G possibly damaging Het
Ackr3 C G 1: 90,214,201 N127K probably damaging Het
AL732309.1 A C 2: 25,246,139 M21R possibly damaging Het
Ankrd52 C A 10: 128,386,163 T552K possibly damaging Het
Arhgap28 T C 17: 67,895,884 probably null Het
Arid5b A T 10: 68,128,922 N306K probably benign Het
C1qtnf3 A C 15: 10,952,621 K56N probably benign Het
C2 C T 17: 34,881,688 G52D probably benign Het
Casz1 C T 4: 148,947,033 T1247M probably damaging Het
Cc2d2b A G 19: 40,809,108 D778G unknown Het
Cdh5 A G 8: 104,142,793 D717G probably damaging Het
Clca3a2 G A 3: 144,808,611 A445V probably damaging Het
Clca3b T A 3: 144,841,420 M319L possibly damaging Het
Csmd1 G A 8: 16,058,707 S1894L probably damaging Het
Csnk1g3 A G 18: 53,919,018 T220A probably damaging Het
Cyp2d10 T G 15: 82,403,760 T381P probably damaging Het
Ddb2 G A 2: 91,236,884 probably benign Het
Ddx24 C A 12: 103,416,259 L688F probably damaging Het
Dennd4c T C 4: 86,829,738 L1615P unknown Het
Dnah8 T A 17: 30,784,125 D3599E probably benign Het
Dst T C 1: 34,006,224 S13P possibly damaging Het
Efcab12 T C 6: 115,823,594 D156G probably benign Het
Enpp2 A G 15: 54,877,774 probably null Het
Ephx2 A G 14: 66,085,354 V490A probably damaging Het
Etnppl A G 3: 130,629,575 N308D probably damaging Het
F5 TCAGAAGACCTCCTCCCCAGACCTGGGCCAGGTGCCCCTTTCTCCAGATGACAACCAGAAGACCTCCTCCCCAGACCTGGGTCAGGTGTCCCTTTCTCCAGATGATAACCAGAAGACCTCCTCCCCAGACCTGGGTCAGGTGCCCCTTTCTCTAGATGACAACCAGAAGACGACCTCCCCAGACCTGGGTCAGGTGCCCCTTTCTCCAGATGACAACCAGA TCAGAAGACCTCCTCCCCAGACCTGGGTCAGGTGTCCCTTTCTCCAGATGATAACCAGAAGACCTCCTCCCCAGACCTGGGTCAGGTGCCCCTTTCTCTAGATGACAACCAGAAGACGACCTCCCCAGACCTGGGTCAGGTGCCCCTTTCTCCAGATGACAACCAGA 1: 164,193,581 probably benign Het
Fam162b A T 10: 51,590,186 probably null Het
Fancl A G 11: 26,403,362 E86G probably damaging Het
Flii G A 11: 60,719,040 T615I probably benign Het
Fndc7 G T 3: 108,872,221 Q336K probably benign Het
Gm14025 T C 2: 129,037,852 D718G unknown Het
Gm26661 T C 14: 7,791,911 C109R unknown Het
H2-DMb1 T C 17: 34,159,462 probably null Het
H2-T10 C T 17: 36,119,297 G251R probably damaging Het
Harbi1 T C 2: 91,720,699 I339T probably benign Het
Hsp90aa1 A G 12: 110,695,225 M119T unknown Het
Ighe T A 12: 113,272,334 Y124F Het
Ighv7-1 T C 12: 113,896,529 Y81C probably damaging Het
Ilkap A T 1: 91,385,393 probably null Het
Inpp5a A G 7: 139,525,670 D179G probably damaging Het
Itgad A T 7: 128,189,807 D510V probably damaging Het
Kcnn2 A T 18: 45,560,071 H238L probably benign Het
Kctd17 T A 15: 78,435,642 C189S probably damaging Het
Larp4b C A 13: 9,158,580 A423E probably benign Het
Llgl2 A G 11: 115,850,730 E562G possibly damaging Het
Macf1 T C 4: 123,374,425 T6734A probably benign Het
Maz G A 7: 127,024,593 T377M probably damaging Het
Mmrn1 G T 6: 60,944,933 G125* probably null Het
Mvp A G 7: 126,993,609 S377P probably benign Het
Nin C T 12: 70,043,734 R969Q Het
Nktr C T 9: 121,727,361 T35I probably damaging Het
Nktr T A 9: 121,748,291 M475K possibly damaging Het
Nod2 T A 8: 88,653,066 V65D probably damaging Het
Olfr1249 A T 2: 89,630,103 I265N possibly damaging Het
Olfr135 T C 17: 38,208,716 V157A probably benign Het
Olfr1487 A G 19: 13,619,578 I96V probably benign Het
Olfr1493-ps1 C T 19: 13,726,906 A215V probably benign Het
Olfr203 T C 16: 59,303,248 F32L probably benign Het
Olfr398 A G 11: 73,983,843 V255A probably benign Het
Olfr794 T A 10: 129,570,849 S65T probably damaging Het
Olfr868 A T 9: 20,101,430 I224F possibly damaging Het
Opa1 A T 16: 29,586,981 E121D probably benign Het
Osbpl2 A G 2: 180,150,201 T233A probably benign Het
Pcp4l1 G A 1: 171,174,465 A42V possibly damaging Het
Plekhh3 T A 11: 101,170,774 D38V possibly damaging Het
Prtg C T 9: 72,890,840 A696V probably damaging Het
Ptpn14 T G 1: 189,863,424 V748G possibly damaging Het
Reg2 A T 6: 78,406,154 D28V probably benign Het
Rhpn1 A T 15: 75,704,397 I2F possibly damaging Het
Rundc3a A G 11: 102,399,973 E294G possibly damaging Het
Scara3 T A 14: 65,931,416 I251L probably benign Het
Slc23a2 G A 2: 132,089,123 T152I probably damaging Het
Slc39a2 T G 14: 51,894,193 S74A possibly damaging Het
Tmprss15 T C 16: 78,962,019 Y937C probably damaging Het
Tpp2 T C 1: 43,978,778 L779S probably damaging Het
Tssk2 T C 16: 17,899,363 V210A possibly damaging Het
Ttn T A 2: 76,895,593 T6100S unknown Het
Tufm G A 7: 126,489,587 E317K possibly damaging Het
Wtap T C 17: 12,980,946 N50S possibly damaging Het
Other mutations in Wdfy4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00231:Wdfy4 APN 14 33102539 missense possibly damaging 0.93
IGL01116:Wdfy4 APN 14 32959977 missense probably damaging 1.00
IGL01449:Wdfy4 APN 14 33104037 missense probably damaging 0.99
IGL01567:Wdfy4 APN 14 33151661 missense probably benign 0.01
IGL01700:Wdfy4 APN 14 33020238 splice site probably benign
IGL01931:Wdfy4 APN 14 33155753 missense probably damaging 1.00
IGL01981:Wdfy4 APN 14 33133716 missense probably damaging 1.00
IGL01988:Wdfy4 APN 14 33076480 missense possibly damaging 0.75
IGL02026:Wdfy4 APN 14 33093300 missense probably damaging 1.00
IGL02066:Wdfy4 APN 14 33149566 missense probably benign
IGL02468:Wdfy4 APN 14 32966432 missense probably benign 0.01
IGL02512:Wdfy4 APN 14 33042491 missense probably benign 0.01
IGL02597:Wdfy4 APN 14 33090861 nonsense probably null
IGL02752:Wdfy4 APN 14 33076326 missense probably damaging 1.00
IGL02792:Wdfy4 APN 14 33095305 missense probably benign 0.01
IGL02826:Wdfy4 APN 14 32971750 missense possibly damaging 0.47
IGL02903:Wdfy4 APN 14 33109650 missense probably damaging 1.00
IGL02955:Wdfy4 APN 14 33076284 missense probably damaging 1.00
IGL03031:Wdfy4 APN 14 33140651 missense probably damaging 1.00
IGL03102:Wdfy4 APN 14 32966435 missense probably damaging 1.00
IGL03123:Wdfy4 APN 14 33162870 missense probably benign 0.01
IGL03198:Wdfy4 APN 14 33125887 missense probably damaging 1.00
IGL03250:Wdfy4 APN 14 32977167 missense probably damaging 0.99
IGL03277:Wdfy4 APN 14 33068904 missense probably benign 0.01
IGL03398:Wdfy4 APN 14 33047290 missense probably benign 0.14
dodgers UTSW 14 32977106 nonsense probably null
Dollar UTSW 14 33020311 missense probably damaging 1.00
Giants UTSW 14 33070618 nonsense probably null
gigantea UTSW 14 32974154 critical splice donor site probably null
kings_canyon UTSW 14 33109519 nonsense probably null
moro UTSW 14 32964626 splice site probably null
sequoia UTSW 14 33100903 critical splice donor site probably null
Sherman UTSW 14 33095951 missense possibly damaging 0.89
watchtower UTSW 14 33083639 critical splice donor site probably null
R0014:Wdfy4 UTSW 14 33107173 missense possibly damaging 0.72
R0067:Wdfy4 UTSW 14 33162751 missense probably null 1.00
R0085:Wdfy4 UTSW 14 33078243 missense possibly damaging 0.81
R0277:Wdfy4 UTSW 14 33083785 missense possibly damaging 0.83
R0436:Wdfy4 UTSW 14 33083812 splice site probably benign
R0496:Wdfy4 UTSW 14 33140738 splice site probably benign
R0514:Wdfy4 UTSW 14 33080775 missense probably benign 0.22
R0548:Wdfy4 UTSW 14 33042621 missense probably benign
R0590:Wdfy4 UTSW 14 33041174 missense probably benign 0.09
R0647:Wdfy4 UTSW 14 33109699 missense possibly damaging 0.96
R0766:Wdfy4 UTSW 14 33140612 missense probably damaging 1.00
R0981:Wdfy4 UTSW 14 33147092 missense probably benign 0.03
R1024:Wdfy4 UTSW 14 33079966 missense possibly damaging 0.81
R1113:Wdfy4 UTSW 14 32971738 missense possibly damaging 0.47
R1252:Wdfy4 UTSW 14 32971772 splice site probably null
R1415:Wdfy4 UTSW 14 33041180 missense possibly damaging 0.60
R1475:Wdfy4 UTSW 14 33108688 missense probably benign 0.14
R1483:Wdfy4 UTSW 14 33100966 missense probably benign 0.41
R1490:Wdfy4 UTSW 14 33152538 critical splice donor site probably null
R1512:Wdfy4 UTSW 14 32960808 missense probably damaging 0.98
R1615:Wdfy4 UTSW 14 33042512 missense probably damaging 1.00
R1628:Wdfy4 UTSW 14 32959961 missense probably damaging 1.00
R1643:Wdfy4 UTSW 14 33073585 critical splice acceptor site probably null
R1729:Wdfy4 UTSW 14 33096005 missense possibly damaging 0.85
R1859:Wdfy4 UTSW 14 33103983 missense probably damaging 0.99
R1933:Wdfy4 UTSW 14 33133344 missense probably benign 0.08
R1957:Wdfy4 UTSW 14 32971684 missense probably damaging 1.00
R1968:Wdfy4 UTSW 14 33106044 missense possibly damaging 0.95
R2032:Wdfy4 UTSW 14 33146989 missense probably benign 0.11
R2241:Wdfy4 UTSW 14 33073511 missense possibly damaging 0.81
R2391:Wdfy4 UTSW 14 33162807 missense possibly damaging 0.92
R2888:Wdfy4 UTSW 14 33109519 nonsense probably null
R2889:Wdfy4 UTSW 14 33109519 nonsense probably null
R3114:Wdfy4 UTSW 14 33089903 missense probably damaging 0.97
R3757:Wdfy4 UTSW 14 33023374 missense probably benign 0.17
R3758:Wdfy4 UTSW 14 33023374 missense probably benign 0.17
R3797:Wdfy4 UTSW 14 33140645 missense probably damaging 1.00
R3890:Wdfy4 UTSW 14 33047280 missense probably damaging 1.00
R3892:Wdfy4 UTSW 14 33047280 missense probably damaging 1.00
R3945:Wdfy4 UTSW 14 32966395 missense probably damaging 0.99
R4011:Wdfy4 UTSW 14 33102680 splice site probably benign
R4091:Wdfy4 UTSW 14 33125880 missense possibly damaging 0.93
R4449:Wdfy4 UTSW 14 33096083 missense probably damaging 1.00
R4585:Wdfy4 UTSW 14 33087955 missense possibly damaging 0.89
R4628:Wdfy4 UTSW 14 33102558 missense probably damaging 0.97
R4629:Wdfy4 UTSW 14 33102558 missense probably damaging 0.97
R4655:Wdfy4 UTSW 14 32989936 missense probably damaging 0.98
R4689:Wdfy4 UTSW 14 33109548 missense possibly damaging 0.88
R4718:Wdfy4 UTSW 14 33145316 missense probably benign 0.03
R4862:Wdfy4 UTSW 14 33100903 critical splice donor site probably null
R4884:Wdfy4 UTSW 14 32988895 nonsense probably null
R4894:Wdfy4 UTSW 14 33155760 missense probably benign 0.03
R4929:Wdfy4 UTSW 14 33047256 missense possibly damaging 0.90
R4932:Wdfy4 UTSW 14 33029013 missense probably damaging 1.00
R5014:Wdfy4 UTSW 14 33100940 missense probably benign 0.02
R5020:Wdfy4 UTSW 14 33079935 missense probably damaging 1.00
R5049:Wdfy4 UTSW 14 33152670 missense possibly damaging 0.78
R5276:Wdfy4 UTSW 14 33047275 missense probably damaging 1.00
R5318:Wdfy4 UTSW 14 33078343 missense possibly damaging 0.95
R5338:Wdfy4 UTSW 14 33090866 missense probably damaging 1.00
R5349:Wdfy4 UTSW 14 32988899 missense probably damaging 1.00
R5411:Wdfy4 UTSW 14 32960002 missense probably damaging 1.00
R5435:Wdfy4 UTSW 14 33020311 missense probably damaging 1.00
R5463:Wdfy4 UTSW 14 33151732 missense probably benign 0.17
R5591:Wdfy4 UTSW 14 33107130 missense probably benign 0.09
R5598:Wdfy4 UTSW 14 33133497 missense probably damaging 1.00
R5654:Wdfy4 UTSW 14 33107618 splice site probably null
R5890:Wdfy4 UTSW 14 33102577 missense possibly damaging 0.91
R5894:Wdfy4 UTSW 14 33133360 missense possibly damaging 0.86
R5964:Wdfy4 UTSW 14 33106011 missense probably damaging 1.00
R6036:Wdfy4 UTSW 14 33146990 missense probably damaging 0.97
R6036:Wdfy4 UTSW 14 33146990 missense probably damaging 0.97
R6074:Wdfy4 UTSW 14 33083639 critical splice donor site probably null
R6135:Wdfy4 UTSW 14 32971711 missense probably damaging 0.99
R6276:Wdfy4 UTSW 14 33109525 missense possibly damaging 0.54
R6357:Wdfy4 UTSW 14 33101049 nonsense probably null
R6370:Wdfy4 UTSW 14 33068850 missense probably benign 0.16
R6390:Wdfy4 UTSW 14 33104094 missense probably damaging 0.99
R6413:Wdfy4 UTSW 14 32967647 missense probably damaging 1.00
R6450:Wdfy4 UTSW 14 33108692 missense probably damaging 1.00
R6522:Wdfy4 UTSW 14 33146944 missense probably damaging 0.98
R6657:Wdfy4 UTSW 14 33047251 missense possibly damaging 0.70
R6761:Wdfy4 UTSW 14 33095951 missense possibly damaging 0.89
R6763:Wdfy4 UTSW 14 33042512 missense probably damaging 1.00
R6952:Wdfy4 UTSW 14 32959966 missense probably damaging 1.00
R6985:Wdfy4 UTSW 14 33099117 missense possibly damaging 0.68
R7024:Wdfy4 UTSW 14 32964626 splice site probably null
R7101:Wdfy4 UTSW 14 32960820 missense
R7114:Wdfy4 UTSW 14 32971574 splice site probably null
R7139:Wdfy4 UTSW 14 33151578 missense
R7255:Wdfy4 UTSW 14 32974282 missense
R7379:Wdfy4 UTSW 14 33151609 missense
R7399:Wdfy4 UTSW 14 33068906 missense
R7408:Wdfy4 UTSW 14 33078307 missense
R7410:Wdfy4 UTSW 14 32974234 missense
R7411:Wdfy4 UTSW 14 33106131 missense
R7412:Wdfy4 UTSW 14 33149584 missense
R7445:Wdfy4 UTSW 14 33070618 nonsense probably null
R7595:Wdfy4 UTSW 14 32974154 critical splice donor site probably null
R7618:Wdfy4 UTSW 14 32985739 missense
R7622:Wdfy4 UTSW 14 33078274 missense
R7828:Wdfy4 UTSW 14 32988921 missense possibly damaging 0.90
R7888:Wdfy4 UTSW 14 33090963 missense
R7946:Wdfy4 UTSW 14 33070748 missense
R7946:Wdfy4 UTSW 14 33104115 missense
R7986:Wdfy4 UTSW 14 33104115 missense
R7990:Wdfy4 UTSW 14 33097795 missense
R8001:Wdfy4 UTSW 14 32973535 critical splice donor site probably null
R8010:Wdfy4 UTSW 14 32971627 missense
R8015:Wdfy4 UTSW 14 33107747 missense
R8032:Wdfy4 UTSW 14 33029086 nonsense probably null
R8041:Wdfy4 UTSW 14 33154008 critical splice donor site probably null
R8090:Wdfy4 UTSW 14 33104115 missense
R8092:Wdfy4 UTSW 14 33104115 missense
R8112:Wdfy4 UTSW 14 33104115 missense
R8114:Wdfy4 UTSW 14 33104115 missense
R8115:Wdfy4 UTSW 14 33104115 missense
R8117:Wdfy4 UTSW 14 32977106 nonsense probably null
R8117:Wdfy4 UTSW 14 33104115 missense
R8118:Wdfy4 UTSW 14 33104115 missense
R8140:Wdfy4 UTSW 14 33142360 missense
R8155:Wdfy4 UTSW 14 33162819 missense
R8163:Wdfy4 UTSW 14 33151588 missense
R8293:Wdfy4 UTSW 14 32974261 missense
R8325:Wdfy4 UTSW 14 32967487 missense
R8370:Wdfy4 UTSW 14 33093251 missense
R8437:Wdfy4 UTSW 14 33076375 missense
X0028:Wdfy4 UTSW 14 33080636 missense probably benign
X0053:Wdfy4 UTSW 14 33162942 start codon destroyed probably null 0.99
X0062:Wdfy4 UTSW 14 33107618 splice site probably null
Z1177:Wdfy4 UTSW 14 33087985 missense
Predicted Primers PCR Primer
(F):5'- ACAAAGGCCCTCTGATTTTCTC -3'
(R):5'- GCCGAGGCTACATTTTGGTG -3'

Sequencing Primer
(F):5'- AAAGGCCCTCTGATTTTCTCTCCTC -3'
(R):5'- TTAAAGAGGAGGGCTGAGTCTCTC -3'
Posted On2019-09-13