Incidental Mutation 'R7324:Slc39a2'
ID568770
Institutional Source Beutler Lab
Gene Symbol Slc39a2
Ensembl Gene ENSMUSG00000072572
Gene Namesolute carrier family 39 (zinc transporter), member 2
Synonymszip2, F730005G13Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.056) question?
Stock #R7324 (G1)
Quality Score225.009
Status Validated
Chromosome14
Chromosomal Location51892889-51896745 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 51894193 bp
ZygosityHeterozygous
Amino Acid Change Serine to Alanine at position 74 (S74A)
Ref Sequence ENSEMBL: ENSMUSP00000038707 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000047726] [ENSMUST00000047899] [ENSMUST00000164252] [ENSMUST00000164902] [ENSMUST00000165100] [ENSMUST00000165568] [ENSMUST00000168217]
Predicted Effect possibly damaging
Transcript: ENSMUST00000047726
AA Change: S74A

PolyPhen 2 Score 0.737 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000038707
Gene: ENSMUSG00000072572
AA Change: S74A

DomainStartEndE-ValueType
Pfam:Zip 5 306 1.1e-59 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000047899
SMART Domains Protein: ENSMUSP00000047720
Gene: ENSMUSG00000004561

DomainStartEndE-ValueType
low complexity region 8 21 N/A INTRINSIC
low complexity region 63 76 N/A INTRINSIC
Pfam:Rsm22 153 442 8e-65 PFAM
Pfam:Methyltransf_11 191 293 5.9e-7 PFAM
low complexity region 446 460 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000164252
SMART Domains Protein: ENSMUSP00000130038
Gene: ENSMUSG00000004561

DomainStartEndE-ValueType
low complexity region 8 21 N/A INTRINSIC
low complexity region 63 76 N/A INTRINSIC
Pfam:Rsm22 153 235 2.1e-19 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000164902
SMART Domains Protein: ENSMUSP00000130200
Gene: ENSMUSG00000004561

DomainStartEndE-ValueType
low complexity region 8 21 N/A INTRINSIC
low complexity region 63 76 N/A INTRINSIC
Pfam:Rsm22 153 467 1.7e-61 PFAM
Pfam:Methyltransf_11 191 294 3.6e-6 PFAM
low complexity region 471 485 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000165100
SMART Domains Protein: ENSMUSP00000132354
Gene: ENSMUSG00000004561

DomainStartEndE-ValueType
low complexity region 8 21 N/A INTRINSIC
low complexity region 63 76 N/A INTRINSIC
Pfam:Rsm22 153 235 2.1e-19 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000165568
SMART Domains Protein: ENSMUSP00000129973
Gene: ENSMUSG00000004561

DomainStartEndE-ValueType
Pfam:Rsm22 100 269 1.5e-37 PFAM
Pfam:Methyltransf_11 138 240 2.1e-7 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000168217
SMART Domains Protein: ENSMUSP00000130565
Gene: ENSMUSG00000004561

DomainStartEndE-ValueType
low complexity region 8 21 N/A INTRINSIC
low complexity region 63 76 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency 99% (81/82)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the ZIP family of metal ion transporters. The encoded protein functions as a zinc transporter. Mutations in this gene may be associated with susceptibility to carotid artery disease. Multiple transcript variants have been described. [provided by RefSeq, Mar 2010]
PHENOTYPE: Homozygotes for a null allele are overtly normal when fed a zinc-replete diet but show increased sensitivity to the effects of maternal dietary zinc deficiency during pregnancy. Resulting embryos are often growth retarded with craniofacial and limb defects, and show altered iron and calcium levels. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 79 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcg5 T C 17: 84,676,239 D124G possibly damaging Het
Ackr3 C G 1: 90,214,201 N127K probably damaging Het
AL732309.1 A C 2: 25,246,139 M21R possibly damaging Het
Ankrd52 C A 10: 128,386,163 T552K possibly damaging Het
Arhgap28 T C 17: 67,895,884 probably null Het
Arid5b A T 10: 68,128,922 N306K probably benign Het
C1qtnf3 A C 15: 10,952,621 K56N probably benign Het
C2 C T 17: 34,881,688 G52D probably benign Het
Casz1 C T 4: 148,947,033 T1247M probably damaging Het
Cc2d2b A G 19: 40,809,108 D778G unknown Het
Cdh5 A G 8: 104,142,793 D717G probably damaging Het
Clca3a2 G A 3: 144,808,611 A445V probably damaging Het
Clca3b T A 3: 144,841,420 M319L possibly damaging Het
Csmd1 G A 8: 16,058,707 S1894L probably damaging Het
Csnk1g3 A G 18: 53,919,018 T220A probably damaging Het
Cyp2d10 T G 15: 82,403,760 T381P probably damaging Het
Ddb2 G A 2: 91,236,884 probably benign Het
Ddx24 C A 12: 103,416,259 L688F probably damaging Het
Dennd4c T C 4: 86,829,738 L1615P unknown Het
Dnah8 T A 17: 30,784,125 D3599E probably benign Het
Dst T C 1: 34,006,224 S13P possibly damaging Het
Efcab12 T C 6: 115,823,594 D156G probably benign Het
Enpp2 A G 15: 54,877,774 probably null Het
Ephx2 A G 14: 66,085,354 V490A probably damaging Het
Etnppl A G 3: 130,629,575 N308D probably damaging Het
F5 TCAGAAGACCTCCTCCCCAGACCTGGGCCAGGTGCCCCTTTCTCCAGATGACAACCAGAAGACCTCCTCCCCAGACCTGGGTCAGGTGTCCCTTTCTCCAGATGATAACCAGAAGACCTCCTCCCCAGACCTGGGTCAGGTGCCCCTTTCTCTAGATGACAACCAGAAGACGACCTCCCCAGACCTGGGTCAGGTGCCCCTTTCTCCAGATGACAACCAGA TCAGAAGACCTCCTCCCCAGACCTGGGTCAGGTGTCCCTTTCTCCAGATGATAACCAGAAGACCTCCTCCCCAGACCTGGGTCAGGTGCCCCTTTCTCTAGATGACAACCAGAAGACGACCTCCCCAGACCTGGGTCAGGTGCCCCTTTCTCCAGATGACAACCAGA 1: 164,193,581 probably benign Het
Fam162b A T 10: 51,590,186 probably null Het
Fancl A G 11: 26,403,362 E86G probably damaging Het
Flii G A 11: 60,719,040 T615I probably benign Het
Fndc7 G T 3: 108,872,221 Q336K probably benign Het
Gm14025 T C 2: 129,037,852 D718G unknown Het
Gm26661 T C 14: 7,791,911 C109R unknown Het
H2-DMb1 T C 17: 34,159,462 probably null Het
H2-T10 C T 17: 36,119,297 G251R probably damaging Het
Harbi1 T C 2: 91,720,699 I339T probably benign Het
Hsp90aa1 A G 12: 110,695,225 M119T unknown Het
Ighe T A 12: 113,272,334 Y124F Het
Ighv7-1 T C 12: 113,896,529 Y81C probably damaging Het
Ilkap A T 1: 91,385,393 probably null Het
Inpp5a A G 7: 139,525,670 D179G probably damaging Het
Itgad A T 7: 128,189,807 D510V probably damaging Het
Kcnn2 A T 18: 45,560,071 H238L probably benign Het
Kctd17 T A 15: 78,435,642 C189S probably damaging Het
Larp4b C A 13: 9,158,580 A423E probably benign Het
Llgl2 A G 11: 115,850,730 E562G possibly damaging Het
Macf1 T C 4: 123,374,425 T6734A probably benign Het
Maz G A 7: 127,024,593 T377M probably damaging Het
Mmrn1 G T 6: 60,944,933 G125* probably null Het
Mvp A G 7: 126,993,609 S377P probably benign Het
Nin C T 12: 70,043,734 R969Q Het
Nktr C T 9: 121,727,361 T35I probably damaging Het
Nktr T A 9: 121,748,291 M475K possibly damaging Het
Nod2 T A 8: 88,653,066 V65D probably damaging Het
Olfr1249 A T 2: 89,630,103 I265N possibly damaging Het
Olfr135 T C 17: 38,208,716 V157A probably benign Het
Olfr1487 A G 19: 13,619,578 I96V probably benign Het
Olfr1493-ps1 C T 19: 13,726,906 A215V probably benign Het
Olfr203 T C 16: 59,303,248 F32L probably benign Het
Olfr398 A G 11: 73,983,843 V255A probably benign Het
Olfr794 T A 10: 129,570,849 S65T probably damaging Het
Olfr868 A T 9: 20,101,430 I224F possibly damaging Het
Opa1 A T 16: 29,586,981 E121D probably benign Het
Osbpl2 A G 2: 180,150,201 T233A probably benign Het
Pcp4l1 G A 1: 171,174,465 A42V possibly damaging Het
Plekhh3 T A 11: 101,170,774 D38V possibly damaging Het
Prtg C T 9: 72,890,840 A696V probably damaging Het
Ptpn14 T G 1: 189,863,424 V748G possibly damaging Het
Reg2 A T 6: 78,406,154 D28V probably benign Het
Rhpn1 A T 15: 75,704,397 I2F possibly damaging Het
Rundc3a A G 11: 102,399,973 E294G possibly damaging Het
Scara3 T A 14: 65,931,416 I251L probably benign Het
Slc23a2 G A 2: 132,089,123 T152I probably damaging Het
Tmprss15 T C 16: 78,962,019 Y937C probably damaging Het
Tpp2 T C 1: 43,978,778 L779S probably damaging Het
Tssk2 T C 16: 17,899,363 V210A possibly damaging Het
Ttn T A 2: 76,895,593 T6100S unknown Het
Tufm G A 7: 126,489,587 E317K possibly damaging Het
Wdfy4 A G 14: 33,047,314 S2219P Het
Wtap T C 17: 12,980,946 N50S possibly damaging Het
Other mutations in Slc39a2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01315:Slc39a2 APN 14 51895136 nonsense probably null
IGL02421:Slc39a2 APN 14 51893872 missense probably benign 0.00
IGL02546:Slc39a2 APN 14 51895163 missense probably benign 0.16
IGL02823:Slc39a2 APN 14 51895412 missense probably damaging 1.00
R1126:Slc39a2 UTSW 14 51894145 missense probably damaging 1.00
R4923:Slc39a2 UTSW 14 51895254 missense probably damaging 1.00
R5106:Slc39a2 UTSW 14 51895531 makesense probably null
R6158:Slc39a2 UTSW 14 51894224 unclassified probably null
R7094:Slc39a2 UTSW 14 51893689 unclassified probably benign
R7340:Slc39a2 UTSW 14 51894203 missense possibly damaging 0.87
R7578:Slc39a2 UTSW 14 51895416 missense probably damaging 1.00
R7599:Slc39a2 UTSW 14 51895031 missense probably benign 0.10
Z1177:Slc39a2 UTSW 14 51893895 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CACCCCACAGATGTTGAGTG -3'
(R):5'- TGCCCTTTCAGCCAACAAGC -3'

Sequencing Primer
(F):5'- CCACAGATGTTGAGTGCCATC -3'
(R):5'- GCCAACAAGCTTTCCTCAGATG -3'
Posted On2019-09-13