Incidental Mutation 'R7324:Wtap'
ID568782
Institutional Source Beutler Lab
Gene Symbol Wtap
Ensembl Gene ENSMUSG00000060475
Gene NameWilms tumour 1-associating protein
Synonyms9430038B09Rik, 2810408K05Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7324 (G1)
Quality Score225.009
Status Validated
Chromosome17
Chromosomal Location12966796-12992546 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 12980946 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Serine at position 50 (N50S)
Ref Sequence ENSEMBL: ENSMUSP00000007007 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000007007] [ENSMUST00000159104] [ENSMUST00000159551] [ENSMUST00000159986] [ENSMUST00000160781] [ENSMUST00000162395]
Predicted Effect possibly damaging
Transcript: ENSMUST00000007007
AA Change: N50S

PolyPhen 2 Score 0.907 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000007007
Gene: ENSMUSG00000060475
AA Change: N50S

DomainStartEndE-ValueType
low complexity region 57 69 N/A INTRINSIC
coiled coil region 121 148 N/A INTRINSIC
coiled coil region 177 248 N/A INTRINSIC
low complexity region 278 291 N/A INTRINSIC
low complexity region 305 327 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000159104
AA Change: N27S

PolyPhen 2 Score 0.168 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000125337
Gene: ENSMUSG00000060475
AA Change: N27S

DomainStartEndE-ValueType
low complexity region 34 46 N/A INTRINSIC
coiled coil region 98 125 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000159551
AA Change: N50S

PolyPhen 2 Score 0.907 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000124205
Gene: ENSMUSG00000060475
AA Change: N50S

DomainStartEndE-ValueType
Pfam:Wtap 1 248 2.8e-157 PFAM
low complexity region 278 291 N/A INTRINSIC
low complexity region 305 327 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000159986
AA Change: N50S

PolyPhen 2 Score 0.141 (Sensitivity: 0.92; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000123961
Gene: ENSMUSG00000060475
AA Change: N50S

DomainStartEndE-ValueType
low complexity region 57 69 N/A INTRINSIC
coiled coil region 121 148 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000160781
AA Change: N50S

PolyPhen 2 Score 0.141 (Sensitivity: 0.92; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000124138
Gene: ENSMUSG00000060475
AA Change: N50S

DomainStartEndE-ValueType
low complexity region 57 69 N/A INTRINSIC
coiled coil region 121 148 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000162395
AA Change: N50S

PolyPhen 2 Score 0.088 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000125419
Gene: ENSMUSG00000060475
AA Change: N50S

DomainStartEndE-ValueType
low complexity region 57 69 N/A INTRINSIC
Meta Mutation Damage Score 0.0610 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency 99% (81/82)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The Wilms tumor suppressor gene WT1 appears to play a role in both transcriptional and posttranscriptional regulation of certain cellular genes. This gene encodes a WT1-associating protein, which is a ubiquitously expressed nuclear protein. Like WT1 protein, this protein is localized throughout the nucleoplasm as well as in speckles and partially colocalizes with splicing factors. Alternative splicing of this gene results in several transcript variants encoding three different isoforms. [provided by RefSeq, Jul 2012]
PHENOTYPE: Mice homozygous for a mutation display lethality during embryogenesis with abnormalities appearing during gastrulation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 79 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcg5 T C 17: 84,676,239 D124G possibly damaging Het
Ackr3 C G 1: 90,214,201 N127K probably damaging Het
AL732309.1 A C 2: 25,246,139 M21R possibly damaging Het
Ankrd52 C A 10: 128,386,163 T552K possibly damaging Het
Arhgap28 T C 17: 67,895,884 probably null Het
Arid5b A T 10: 68,128,922 N306K probably benign Het
C1qtnf3 A C 15: 10,952,621 K56N probably benign Het
C2 C T 17: 34,881,688 G52D probably benign Het
Casz1 C T 4: 148,947,033 T1247M probably damaging Het
Cc2d2b A G 19: 40,809,108 D778G unknown Het
Cdh5 A G 8: 104,142,793 D717G probably damaging Het
Clca3a2 G A 3: 144,808,611 A445V probably damaging Het
Clca3b T A 3: 144,841,420 M319L possibly damaging Het
Csmd1 G A 8: 16,058,707 S1894L probably damaging Het
Csnk1g3 A G 18: 53,919,018 T220A probably damaging Het
Cyp2d10 T G 15: 82,403,760 T381P probably damaging Het
Ddb2 G A 2: 91,236,884 probably benign Het
Ddx24 C A 12: 103,416,259 L688F probably damaging Het
Dennd4c T C 4: 86,829,738 L1615P unknown Het
Dnah8 T A 17: 30,784,125 D3599E probably benign Het
Dst T C 1: 34,006,224 S13P possibly damaging Het
Efcab12 T C 6: 115,823,594 D156G probably benign Het
Enpp2 A G 15: 54,877,774 probably null Het
Ephx2 A G 14: 66,085,354 V490A probably damaging Het
Etnppl A G 3: 130,629,575 N308D probably damaging Het
F5 TCAGAAGACCTCCTCCCCAGACCTGGGCCAGGTGCCCCTTTCTCCAGATGACAACCAGAAGACCTCCTCCCCAGACCTGGGTCAGGTGTCCCTTTCTCCAGATGATAACCAGAAGACCTCCTCCCCAGACCTGGGTCAGGTGCCCCTTTCTCTAGATGACAACCAGAAGACGACCTCCCCAGACCTGGGTCAGGTGCCCCTTTCTCCAGATGACAACCAGA TCAGAAGACCTCCTCCCCAGACCTGGGTCAGGTGTCCCTTTCTCCAGATGATAACCAGAAGACCTCCTCCCCAGACCTGGGTCAGGTGCCCCTTTCTCTAGATGACAACCAGAAGACGACCTCCCCAGACCTGGGTCAGGTGCCCCTTTCTCCAGATGACAACCAGA 1: 164,193,581 probably benign Het
Fam162b A T 10: 51,590,186 probably null Het
Fancl A G 11: 26,403,362 E86G probably damaging Het
Flii G A 11: 60,719,040 T615I probably benign Het
Fndc7 G T 3: 108,872,221 Q336K probably benign Het
Gm14025 T C 2: 129,037,852 D718G unknown Het
Gm26661 T C 14: 7,791,911 C109R unknown Het
H2-DMb1 T C 17: 34,159,462 probably null Het
H2-T10 C T 17: 36,119,297 G251R probably damaging Het
Harbi1 T C 2: 91,720,699 I339T probably benign Het
Hsp90aa1 A G 12: 110,695,225 M119T unknown Het
Ighe T A 12: 113,272,334 Y124F Het
Ighv7-1 T C 12: 113,896,529 Y81C probably damaging Het
Ilkap A T 1: 91,385,393 probably null Het
Inpp5a A G 7: 139,525,670 D179G probably damaging Het
Itgad A T 7: 128,189,807 D510V probably damaging Het
Kcnn2 A T 18: 45,560,071 H238L probably benign Het
Kctd17 T A 15: 78,435,642 C189S probably damaging Het
Larp4b C A 13: 9,158,580 A423E probably benign Het
Llgl2 A G 11: 115,850,730 E562G possibly damaging Het
Macf1 T C 4: 123,374,425 T6734A probably benign Het
Maz G A 7: 127,024,593 T377M probably damaging Het
Mmrn1 G T 6: 60,944,933 G125* probably null Het
Mvp A G 7: 126,993,609 S377P probably benign Het
Nin C T 12: 70,043,734 R969Q Het
Nktr C T 9: 121,727,361 T35I probably damaging Het
Nktr T A 9: 121,748,291 M475K possibly damaging Het
Nod2 T A 8: 88,653,066 V65D probably damaging Het
Olfr1249 A T 2: 89,630,103 I265N possibly damaging Het
Olfr135 T C 17: 38,208,716 V157A probably benign Het
Olfr1487 A G 19: 13,619,578 I96V probably benign Het
Olfr1493-ps1 C T 19: 13,726,906 A215V probably benign Het
Olfr203 T C 16: 59,303,248 F32L probably benign Het
Olfr398 A G 11: 73,983,843 V255A probably benign Het
Olfr794 T A 10: 129,570,849 S65T probably damaging Het
Olfr868 A T 9: 20,101,430 I224F possibly damaging Het
Opa1 A T 16: 29,586,981 E121D probably benign Het
Osbpl2 A G 2: 180,150,201 T233A probably benign Het
Pcp4l1 G A 1: 171,174,465 A42V possibly damaging Het
Plekhh3 T A 11: 101,170,774 D38V possibly damaging Het
Prtg C T 9: 72,890,840 A696V probably damaging Het
Ptpn14 T G 1: 189,863,424 V748G possibly damaging Het
Reg2 A T 6: 78,406,154 D28V probably benign Het
Rhpn1 A T 15: 75,704,397 I2F possibly damaging Het
Rundc3a A G 11: 102,399,973 E294G possibly damaging Het
Scara3 T A 14: 65,931,416 I251L probably benign Het
Slc23a2 G A 2: 132,089,123 T152I probably damaging Het
Slc39a2 T G 14: 51,894,193 S74A possibly damaging Het
Tmprss15 T C 16: 78,962,019 Y937C probably damaging Het
Tpp2 T C 1: 43,978,778 L779S probably damaging Het
Tssk2 T C 16: 17,899,363 V210A possibly damaging Het
Ttn T A 2: 76,895,593 T6100S unknown Het
Tufm G A 7: 126,489,587 E317K possibly damaging Het
Wdfy4 A G 14: 33,047,314 S2219P Het
Other mutations in Wtap
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01305:Wtap APN 17 12967895 missense probably benign 0.08
IGL01867:Wtap APN 17 12969455 missense probably benign 0.00
IGL02379:Wtap APN 17 12969449 missense probably benign
IGL02437:Wtap APN 17 12967733 missense probably benign
IGL02975:Wtap APN 17 12983511 missense possibly damaging 0.85
ANU22:Wtap UTSW 17 12967895 missense probably benign 0.08
R1457:Wtap UTSW 17 12981744 splice site probably null
R1799:Wtap UTSW 17 12980884 missense possibly damaging 0.96
R2240:Wtap UTSW 17 12975465 nonsense probably null
R2328:Wtap UTSW 17 12967538 missense possibly damaging 0.53
R2332:Wtap UTSW 17 12967538 missense possibly damaging 0.53
R3426:Wtap UTSW 17 12967538 missense possibly damaging 0.53
R4382:Wtap UTSW 17 12975420 missense probably damaging 0.99
R4703:Wtap UTSW 17 12980824 missense probably benign 0.23
R4879:Wtap UTSW 17 12969435 missense probably damaging 0.99
R4956:Wtap UTSW 17 12967536 missense probably benign 0.06
R5044:Wtap UTSW 17 12967638 missense possibly damaging 0.47
R6366:Wtap UTSW 17 12968058 splice site probably null
R6813:Wtap UTSW 17 12967510 missense probably damaging 0.96
R7443:Wtap UTSW 17 12980934 missense probably benign 0.05
R7810:Wtap UTSW 17 12980910 missense probably damaging 0.99
R7939:Wtap UTSW 17 12981796 nonsense probably null
T0970:Wtap UTSW 17 12969390 unclassified probably benign
X0067:Wtap UTSW 17 12985929 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGATAGCAAAAGGTACACAGACTC -3'
(R):5'- AAGCAGCTCAGTGTGACTCC -3'

Sequencing Primer
(F):5'- TTTAATCCCAGCACTCGGGAG -3'
(R):5'- TCAGTGTGACTCCCTGGG -3'
Posted On2019-09-13