Incidental Mutation 'R7325:Cdan1'
ID568800
Institutional Source Beutler Lab
Gene Symbol Cdan1
Ensembl Gene ENSMUSG00000027284
Gene Namecongenital dyserythropoietic anemia, type I (human)
Synonymscodanin-1, CDA-I, CDA1, 1500015A01Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7325 (G1)
Quality Score225.009
Status Validated
Chromosome2
Chromosomal Location120716154-120850128 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 120724704 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Arginine at position 797 (Q797R)
Ref Sequence ENSEMBL: ENSMUSP00000106329 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000110700] [ENSMUST00000110701] [ENSMUST00000154193]
Predicted Effect probably benign
Transcript: ENSMUST00000110700
AA Change: Q797R

PolyPhen 2 Score 0.430 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000106328
Gene: ENSMUSG00000027284
AA Change: Q797R

DomainStartEndE-ValueType
low complexity region 25 42 N/A INTRINSIC
low complexity region 78 99 N/A INTRINSIC
low complexity region 102 151 N/A INTRINSIC
low complexity region 154 180 N/A INTRINSIC
low complexity region 326 337 N/A INTRINSIC
low complexity region 561 576 N/A INTRINSIC
low complexity region 724 735 N/A INTRINSIC
Pfam:Codanin-1_C 786 906 2.4e-48 PFAM
low complexity region 1157 1171 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000110701
AA Change: Q797R

PolyPhen 2 Score 0.246 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000106329
Gene: ENSMUSG00000027284
AA Change: Q797R

DomainStartEndE-ValueType
low complexity region 77 98 N/A INTRINSIC
low complexity region 101 150 N/A INTRINSIC
low complexity region 153 179 N/A INTRINSIC
low complexity region 326 337 N/A INTRINSIC
low complexity region 561 576 N/A INTRINSIC
low complexity region 724 735 N/A INTRINSIC
Pfam:Codanin-1_C 789 904 2.4e-41 PFAM
low complexity region 1164 1178 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000154193
SMART Domains Protein: ENSMUSP00000116900
Gene: ENSMUSG00000033705

DomainStartEndE-ValueType
low complexity region 63 77 N/A INTRINSIC
coiled coil region 409 450 N/A INTRINSIC
low complexity region 454 463 N/A INTRINSIC
low complexity region 469 486 N/A INTRINSIC
low complexity region 546 567 N/A INTRINSIC
SCOP:d1jssa_ 588 784 4e-29 SMART
Blast:START 589 785 6e-12 BLAST
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 100% (62/62)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that appears to play a role in nuclear envelope integrity, possibly related to microtubule attachments. Mutations in this gene cause congenital dyserythropoietic anemia type I, a disease resulting in morphological and functional abnormalities of erythropoiesis. [provided by RefSeq, Jul 2009]
PHENOTYPE: Mice homozygous for a gene trapped allele exhibit complete embryonic lethality between implantation and somite formation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrb3 T A 1: 25,532,630 Q402L probably benign Het
Afap1l1 T C 18: 61,736,846 T638A probably benign Het
Agtr1a A C 13: 30,381,907 K318N possibly damaging Het
Anks1b A G 10: 90,941,432 T1095A probably damaging Het
Ap3d1 A T 10: 80,723,803 I207N probably damaging Het
Arhgef11 T C 3: 87,713,292 L484P possibly damaging Het
Astn2 C T 4: 65,542,669 S1076N probably benign Het
Baat C A 4: 49,490,213 L290F probably benign Het
Boll T C 1: 55,304,598 Y222C probably damaging Het
Bphl A T 13: 34,050,341 I147F possibly damaging Het
C330027C09Rik T A 16: 49,005,821 M417K probably benign Het
Cadps2 T G 6: 23,409,935 D766A unknown Het
Cd300lb T A 11: 114,925,032 K210M probably damaging Het
Celsr1 T A 15: 86,033,008 S255C probably damaging Het
Csmd1 G A 8: 16,058,707 S1894L probably damaging Het
Dennd5b T A 6: 149,020,570 K815N probably benign Het
Exd1 A G 2: 119,520,139 V547A probably benign Het
Fbxo15 C T 18: 84,959,118 R52C probably damaging Het
Fip1l1 A G 5: 74,536,799 probably null Het
Flg2 T A 3: 93,203,372 N902K unknown Het
Fyttd1 T A 16: 32,884,248 N76K probably benign Het
Gins1 T A 2: 150,916,166 D57E probably benign Het
Gm5565 G C 5: 146,158,361 probably null Het
Gm6614 T C 6: 141,989,225 K379E probably damaging Het
Gpsm2 T C 3: 108,702,928 Y72C probably damaging Het
Hace1 C A 10: 45,589,507 S53* probably null Het
Insig2 A G 1: 121,306,937 V188A possibly damaging Het
Ism1 T C 2: 139,757,043 V312A probably damaging Het
Jmy A T 13: 93,472,743 Y353N probably damaging Het
Maats1 T A 16: 38,321,601 probably null Het
Maz A C 7: 127,025,553 V265G probably benign Het
Mtmr14 T A 6: 113,269,548 I426N probably damaging Het
Olfr1054 A G 2: 86,333,000 S119P possibly damaging Het
Olfr1467 A G 19: 13,364,637 E3G probably benign Het
Olfr394 C T 11: 73,888,275 M32I probably benign Het
Pcdhac2 T A 18: 37,145,360 N464K probably damaging Het
Pcdhb7 T A 18: 37,343,387 H525Q probably benign Het
Pcp4l1 G A 1: 171,174,465 A42V possibly damaging Het
Podn C T 4: 108,017,702 probably null Het
Prim1 A G 10: 128,022,919 D232G probably null Het
Prrt1 T A 17: 34,632,187 M283K possibly damaging Het
Rgs9 A T 11: 109,276,581 I65N probably damaging Het
Scgb2b26 C A 7: 33,944,357 V53L probably benign Het
Shank2 C A 7: 144,411,685 P1010Q probably benign Het
Slc12a4 C T 8: 105,955,715 G121S probably damaging Het
Slc17a6 G T 7: 51,645,018 A158S probably damaging Het
Slc9a9 C T 9: 94,712,898 H154Y probably benign Het
Slco2a1 T A 9: 103,085,749 probably null Het
Snapc3 T C 4: 83,435,270 I182T probably benign Het
Taok2 A G 7: 126,871,088 V856A probably benign Het
Tep1 T A 14: 50,866,038 N265I probably damaging Het
Tespa1 A T 10: 130,362,041 N311Y probably damaging Het
Tpmt G A 13: 47,041,484 Q14* probably null Het
Trim33 T C 3: 103,321,636 F353L possibly damaging Het
Upp1 T C 11: 9,134,743 V154A probably damaging Het
Usp34 T C 11: 23,419,052 I1747T Het
Vmn1r47 T C 6: 90,022,272 S129P probably benign Het
Vmn2r93 A G 17: 18,303,987 Y81C probably benign Het
Ybx2 A T 11: 69,940,355 T259S probably benign Het
Zfp536 T C 7: 37,479,860 T1107A probably benign Het
Zfp583 C T 7: 6,316,586 A476T probably damaging Het
Other mutations in Cdan1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01592:Cdan1 APN 2 120725985 missense probably damaging 1.00
IGL01660:Cdan1 APN 2 120725653 missense possibly damaging 0.63
IGL01930:Cdan1 APN 2 120726582 intron probably benign
IGL02597:Cdan1 APN 2 120725239 missense probably benign 0.08
IGL03025:Cdan1 APN 2 120730741 missense probably damaging 1.00
IGL03130:Cdan1 APN 2 120727912 missense possibly damaging 0.94
IGL03388:Cdan1 APN 2 120730511 utr 3 prime probably benign
FR4737:Cdan1 UTSW 2 120724971 missense probably damaging 0.96
R0001:Cdan1 UTSW 2 120723751 missense probably benign 0.41
R0650:Cdan1 UTSW 2 120726045 missense probably benign 0.00
R0781:Cdan1 UTSW 2 120720602 missense probably damaging 1.00
R0881:Cdan1 UTSW 2 120720985 missense probably damaging 1.00
R1110:Cdan1 UTSW 2 120720602 missense probably damaging 1.00
R1345:Cdan1 UTSW 2 120719139 critical splice donor site probably null
R1370:Cdan1 UTSW 2 120719139 critical splice donor site probably null
R1503:Cdan1 UTSW 2 120729575 missense probably damaging 1.00
R1579:Cdan1 UTSW 2 120730739 missense probably damaging 0.98
R1664:Cdan1 UTSW 2 120720506 missense probably damaging 0.99
R1749:Cdan1 UTSW 2 120729799 missense probably damaging 0.96
R1765:Cdan1 UTSW 2 120720749 missense probably damaging 1.00
R1806:Cdan1 UTSW 2 120731426 utr 3 prime probably benign
R1856:Cdan1 UTSW 2 120724936 missense probably benign
R2202:Cdan1 UTSW 2 120720760 missense probably damaging 1.00
R2203:Cdan1 UTSW 2 120720760 missense probably damaging 1.00
R2204:Cdan1 UTSW 2 120720760 missense probably damaging 1.00
R3957:Cdan1 UTSW 2 120725632 missense probably damaging 1.00
R3957:Cdan1 UTSW 2 120731020 utr 3 prime probably benign
R4060:Cdan1 UTSW 2 120725743 missense probably benign 0.00
R4324:Cdan1 UTSW 2 120724979 missense probably damaging 0.97
R4379:Cdan1 UTSW 2 120726618 missense probably damaging 1.00
R4611:Cdan1 UTSW 2 120730720 missense probably damaging 0.96
R4695:Cdan1 UTSW 2 120728383 missense probably damaging 1.00
R4866:Cdan1 UTSW 2 120731447 utr 3 prime probably benign
R5183:Cdan1 UTSW 2 120729580 missense probably damaging 0.96
R5347:Cdan1 UTSW 2 120730065 missense possibly damaging 0.95
R5789:Cdan1 UTSW 2 120729535 missense probably benign 0.22
R5958:Cdan1 UTSW 2 120723902 missense possibly damaging 0.80
R6608:Cdan1 UTSW 2 120726680 missense possibly damaging 0.78
R7055:Cdan1 UTSW 2 120727861 missense probably damaging 0.97
R7065:Cdan1 UTSW 2 120718921 missense probably benign 0.00
R7225:Cdan1 UTSW 2 120724912 missense probably benign
R7238:Cdan1 UTSW 2 120730302 missense probably benign
R7316:Cdan1 UTSW 2 120728332 critical splice donor site probably null
R7432:Cdan1 UTSW 2 120722755 missense probably damaging 1.00
R7517:Cdan1 UTSW 2 120727924 missense probably damaging 1.00
R7691:Cdan1 UTSW 2 120729567 missense probably damaging 1.00
R8004:Cdan1 UTSW 2 120731443 missense unknown
X0050:Cdan1 UTSW 2 120724145 missense probably benign 0.29
Z1088:Cdan1 UTSW 2 120730336 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- ACATCATGGCCTTTGTGGGG -3'
(R):5'- GAGGTGACTACAACTGCTTCAG -3'

Sequencing Primer
(F):5'- TTTGTGGGGCAAAGACGATG -3'
(R):5'- TGTCACACCAGATAAATGAGCTG -3'
Posted On2019-09-13