Mutagenetix > Incidental Mutations

Incidental Mutation 'R7325:Arhgef11'

568803

Institutional Source

Beutler Lab

Gene Symbol

Arhgef11

Ensembl Gene

ENSMUSG00000041977

Gene Name

Rho guanine nucleotide exchange factor (GEF) 11

Synonyms

Prg, PDZ-RhoGEF

MMRRC Submission

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R7325 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

87617559-87738034 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 87713292 bp

Zygosity

Heterozygous

Amino Acid Change

Leucine to Proline at position 484 (L484P)

Ref Sequence

ENSEMBL: ENSMUSP00000039900 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000039476] [ENSMUST00000129113] [ENSMUST00000152006]

Predicted Effect

possibly damaging
Transcript: ENSMUST00000039476
AA Change: L484P

PolyPhen 2 Score 0.619 (Sensitivity: 0.87; Specificity: 0.91)

SMART Domains

Protein: ENSMUSP00000039900
Gene: ENSMUSG00000041977
AA Change: L484P

Domain	Start	End	E-Value	Type
low complexity region	12	18	N/A	INTRINSIC
PDZ	55	123	2.45e-18	SMART
low complexity region	149	160	N/A	INTRINSIC
coiled coil region	205	231	N/A	INTRINSIC
RGS	353	472	3.36e-11	SMART
low complexity region	554	565	N/A	INTRINSIC
low complexity region	625	639	N/A	INTRINSIC
low complexity region	681	694	N/A	INTRINSIC
RhoGEF	768	952	1.11e-65	SMART
PH	996	1111	9.49e-6	SMART
low complexity region	1153	1166	N/A	INTRINSIC
low complexity region	1176	1188	N/A	INTRINSIC
low complexity region	1333	1343	N/A	INTRINSIC
low complexity region	1357	1367	N/A	INTRINSIC
low complexity region	1478	1490	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000129113
AA Change: L444P

PolyPhen 2 Score 0.465 (Sensitivity: 0.89; Specificity: 0.90)

SMART Domains

Protein: ENSMUSP00000118123
Gene: ENSMUSG00000041977
AA Change: L444P

Domain	Start	End	E-Value	Type
low complexity region	12	18	N/A	INTRINSIC
PDZ	55	123	2.45e-18	SMART
low complexity region	149	160	N/A	INTRINSIC
RGS	313	432	3.36e-11	SMART
low complexity region	596	610	N/A	INTRINSIC
low complexity region	652	665	N/A	INTRINSIC
RhoGEF	739	923	1.11e-65	SMART
PH	967	1082	9.49e-6	SMART
low complexity region	1124	1137	N/A	INTRINSIC
low complexity region	1147	1159	N/A	INTRINSIC
low complexity region	1304	1314	N/A	INTRINSIC
low complexity region	1328	1338	N/A	INTRINSIC
low complexity region	1449	1461	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000152006
AA Change: L484P

PolyPhen 2 Score 0.465 (Sensitivity: 0.89; Specificity: 0.90)

SMART Domains

Protein: ENSMUSP00000122166
Gene: ENSMUSG00000041977
AA Change: L484P

Domain	Start	End	E-Value	Type
low complexity region	12	18	N/A	INTRINSIC
PDZ	55	123	2.45e-18	SMART
low complexity region	149	160	N/A	INTRINSIC
coiled coil region	205	231	N/A	INTRINSIC
RGS	353	472	3.36e-11	SMART
low complexity region	554	565	N/A	INTRINSIC

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.7%
20x: 99.1%

Validation Efficiency

100% (62/62)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Rho GTPases play a fundamental role in numerous cellular processes that are initiated by extracellular stimuli that work through G protein coupled receptors. The encoded protein may form a complex with G proteins and stimulate Rho-dependent signals. A similar protein in rat interacts with glutamate transporter EAAT4 and modulates its glutamate transport activity. Expression of the rat protein induces the reorganization of the actin cytoskeleton and its overexpression induces the formation of membrane ruffling and filopodia. Two alternative transcripts encoding different isoforms have been described. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit no obvious phenotype. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 61 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adgrb3	T	A	1: 25,532,630	Q402L	probably benign	Het
Afap1l1	T	C	18: 61,736,846	T638A	probably benign	Het
Agtr1a	A	C	13: 30,381,907	K318N	possibly damaging	Het
Anks1b	A	G	10: 90,941,432	T1095A	probably damaging	Het
Ap3d1	A	T	10: 80,723,803	I207N	probably damaging	Het
Astn2	C	T	4: 65,542,669	S1076N	probably benign	Het
Baat	C	A	4: 49,490,213	L290F	probably benign	Het
Boll	T	C	1: 55,304,598	Y222C	probably damaging	Het
Bphl	A	T	13: 34,050,341	I147F	possibly damaging	Het
C330027C09Rik	T	A	16: 49,005,821	M417K	probably benign	Het
Cadps2	T	G	6: 23,409,935	D766A	unknown	Het
Cd300lb	T	A	11: 114,925,032	K210M	probably damaging	Het
Cdan1	T	C	2: 120,724,704	Q797R	probably benign	Het
Celsr1	T	A	15: 86,033,008	S255C	probably damaging	Het
Csmd1	G	A	8: 16,058,707	S1894L	probably damaging	Het
Dennd5b	T	A	6: 149,020,570	K815N	probably benign	Het
Exd1	A	G	2: 119,520,139	V547A	probably benign	Het
Fbxo15	C	T	18: 84,959,118	R52C	probably damaging	Het
Fip1l1	A	G	5: 74,536,799		probably null	Het
Flg2	T	A	3: 93,203,372	N902K	unknown	Het
Fyttd1	T	A	16: 32,884,248	N76K	probably benign	Het
Gins1	T	A	2: 150,916,166	D57E	probably benign	Het
Gm5565	G	C	5: 146,158,361		probably null	Het
Gm6614	T	C	6: 141,989,225	K379E	probably damaging	Het
Gpsm2	T	C	3: 108,702,928	Y72C	probably damaging	Het
Hace1	C	A	10: 45,589,507	S53*	probably null	Het
Insig2	A	G	1: 121,306,937	V188A	possibly damaging	Het
Ism1	T	C	2: 139,757,043	V312A	probably damaging	Het
Jmy	A	T	13: 93,472,743	Y353N	probably damaging	Het
Maats1	T	A	16: 38,321,601		probably null	Het
Maz	A	C	7: 127,025,553	V265G	probably benign	Het
Mtmr14	T	A	6: 113,269,548	I426N	probably damaging	Het
Olfr1054	A	G	2: 86,333,000	S119P	possibly damaging	Het
Olfr1467	A	G	19: 13,364,637	E3G	probably benign	Het
Olfr394	C	T	11: 73,888,275	M32I	probably benign	Het
Pcdhac2	T	A	18: 37,145,360	N464K	probably damaging	Het
Pcdhb7	T	A	18: 37,343,387	H525Q	probably benign	Het
Pcp4l1	G	A	1: 171,174,465	A42V	possibly damaging	Het
Podn	C	T	4: 108,017,702		probably null	Het
Prim1	A	G	10: 128,022,919	D232G	probably null	Het
Prrt1	T	A	17: 34,632,187	M283K	possibly damaging	Het
Rgs9	A	T	11: 109,276,581	I65N	probably damaging	Het
Scgb2b26	C	A	7: 33,944,357	V53L	probably benign	Het
Shank2	C	A	7: 144,411,685	P1010Q	probably benign	Het
Slc12a4	C	T	8: 105,955,715	G121S	probably damaging	Het
Slc17a6	G	T	7: 51,645,018	A158S	probably damaging	Het
Slc9a9	C	T	9: 94,712,898	H154Y	probably benign	Het
Slco2a1	T	A	9: 103,085,749		probably null	Het
Snapc3	T	C	4: 83,435,270	I182T	probably benign	Het
Taok2	A	G	7: 126,871,088	V856A	probably benign	Het
Tep1	T	A	14: 50,866,038	N265I	probably damaging	Het
Tespa1	A	T	10: 130,362,041	N311Y	probably damaging	Het
Tpmt	G	A	13: 47,041,484	Q14*	probably null	Het
Trim33	T	C	3: 103,321,636	F353L	possibly damaging	Het
Upp1	T	C	11: 9,134,743	V154A	probably damaging	Het
Usp34	T	C	11: 23,419,052	I1747T		Het
Vmn1r47	T	C	6: 90,022,272	S129P	probably benign	Het
Vmn2r93	A	G	17: 18,303,987	Y81C	probably benign	Het
Ybx2	A	T	11: 69,940,355	T259S	probably benign	Het
Zfp536	T	C	7: 37,479,860	T1107A	probably benign	Het
Zfp583	C	T	7: 6,316,586	A476T	probably damaging	Het

Other mutations in Arhgef11

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00898:Arhgef11	APN	3	87729503	missense	probably damaging	1.00
IGL00900:Arhgef11	APN	3	87683560	missense	possibly damaging	0.71
IGL01291:Arhgef11	APN	3	87733174	missense	probably benign	0.00
IGL01475:Arhgef11	APN	3	87727126	splice site	probably benign
IGL01599:Arhgef11	APN	3	87737046	missense	probably benign
IGL02251:Arhgef11	APN	3	87683547	missense	probably damaging	1.00
IGL02651:Arhgef11	APN	3	87698864	missense	probably damaging	0.99
IGL02884:Arhgef11	APN	3	87728006	missense	probably damaging	1.00
IGL02900:Arhgef11	APN	3	87733160	missense	probably benign	0.07
IGL03017:Arhgef11	APN	3	87717060	nonsense	probably null
ANU05:Arhgef11	UTSW	3	87733174	missense	probably benign	0.00
R0049:Arhgef11	UTSW	3	87729193	splice site	probably null
R0049:Arhgef11	UTSW	3	87729193	splice site	probably null
R0129:Arhgef11	UTSW	3	87728063	missense	probably damaging	1.00
R0486:Arhgef11	UTSW	3	87688852	splice site	probably null
R0698:Arhgef11	UTSW	3	87733459	missense	probably benign	0.24
R0701:Arhgef11	UTSW	3	87733459	missense	probably benign	0.24
R0849:Arhgef11	UTSW	3	87735896	missense	probably benign	0.24
R1055:Arhgef11	UTSW	3	87717118	missense	probably benign	0.19
R1256:Arhgef11	UTSW	3	87727135	missense	possibly damaging	0.81
R1401:Arhgef11	UTSW	3	87733469	nonsense	probably null
R1543:Arhgef11	UTSW	3	87713017	missense	probably benign	0.10
R1547:Arhgef11	UTSW	3	87695402	missense	possibly damaging	0.87
R1564:Arhgef11	UTSW	3	87702510	missense	probably benign
R1675:Arhgef11	UTSW	3	87731211	missense	possibly damaging	0.84
R2082:Arhgef11	UTSW	3	87725996	missense	possibly damaging	0.47
R2293:Arhgef11	UTSW	3	87727990	missense	probably damaging	1.00
R4739:Arhgef11	UTSW	3	87697999	missense	possibly damaging	0.47
R4930:Arhgef11	UTSW	3	87728594	missense	probably damaging	1.00
R5130:Arhgef11	UTSW	3	87726014	missense	possibly damaging	0.71
R5151:Arhgef11	UTSW	3	87735360	missense	probably damaging	1.00
R5157:Arhgef11	UTSW	3	87728510	splice site	probably null
R5203:Arhgef11	UTSW	3	87735357	missense	probably damaging	1.00
R5329:Arhgef11	UTSW	3	87679752	intron	probably benign
R5615:Arhgef11	UTSW	3	87722485	critical splice donor site	probably null
R5646:Arhgef11	UTSW	3	87684486	missense	possibly damaging	0.94
R6125:Arhgef11	UTSW	3	87729602	missense	probably damaging	1.00
R6242:Arhgef11	UTSW	3	87728078	missense	probably benign
R6543:Arhgef11	UTSW	3	87733408	missense	probably benign	0.09
R6801:Arhgef11	UTSW	3	87735852	missense	possibly damaging	0.53
R6939:Arhgef11	UTSW	3	87686920	missense	probably damaging	1.00
R7008:Arhgef11	UTSW	3	87729218	missense	possibly damaging	0.92
R7155:Arhgef11	UTSW	3	87709572	nonsense	probably null
R7169:Arhgef11	UTSW	3	87727448	missense	possibly damaging	0.79
R7392:Arhgef11	UTSW	3	87717175	critical splice donor site	probably null
R7683:Arhgef11	UTSW	3	87722383	missense	probably damaging	0.98
R7875:Arhgef11	UTSW	3	87684501	missense	probably damaging	1.00
R7912:Arhgef11	UTSW	3	87733222	missense	probably damaging	1.00
R7980:Arhgef11	UTSW	3	87697990	missense	probably benign	0.01
R8028:Arhgef11	UTSW	3	87735552	missense	probably benign
R8081:Arhgef11	UTSW	3	87725642	missense	probably damaging	1.00
R8118:Arhgef11	UTSW	3	87735857	missense	probably damaging	1.00
R8207:Arhgef11	UTSW	3	87698775	missense	possibly damaging	0.71
R8290:Arhgef11	UTSW	3	87725968	missense	probably damaging	1.00
R8443:Arhgef11	UTSW	3	87713099	missense	probably benign	0.17
R8543:Arhgef11	UTSW	3	87681874	missense	probably damaging	1.00
X0011:Arhgef11	UTSW	3	87722406	missense	probably benign
Z1176:Arhgef11	UTSW	3	87735462	missense	not run

Predicted Primers

PCR Primer
(F):5'- AATGACTATAGGTTTGCGAGCC -3'
(R):5'- ACTAGAGAGTGGTCAGCAGC -3'

Sequencing Primer
(F):5'- ATAGGTTTGCGAGCCCCTCTG -3'
(R):5'- AGAGTGGTCAGCAGCTCCAG -3'

Posted On

2019-09-13