Incidental Mutation 'R7325:Flg2'
ID568804
Institutional Source Beutler Lab
Gene Symbol Flg2
Ensembl Gene ENSMUSG00000049133
Gene Namefilaggrin family member 2
SynonymsEG229574
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.098) question?
Stock #R7325 (G1)
Quality Score225.009
Status Validated
Chromosome3
Chromosomal Location93197278-93221391 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 93203372 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Lysine at position 902 (N902K)
Ref Sequence ENSEMBL: ENSMUSP00000096482 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000098884]
Predicted Effect unknown
Transcript: ENSMUST00000098884
AA Change: N902K
SMART Domains Protein: ENSMUSP00000096482
Gene: ENSMUSG00000049133
AA Change: N902K

DomainStartEndE-ValueType
Pfam:S_100 4 46 1.2e-17 PFAM
low complexity region 58 70 N/A INTRINSIC
low complexity region 110 121 N/A INTRINSIC
low complexity region 131 146 N/A INTRINSIC
low complexity region 207 223 N/A INTRINSIC
internal_repeat_2 230 347 7.36e-7 PROSPERO
internal_repeat_2 349 466 7.36e-7 PROSPERO
internal_repeat_3 366 392 6.93e-6 PROSPERO
internal_repeat_6 419 471 4.17e-5 PROSPERO
low complexity region 474 550 N/A INTRINSIC
low complexity region 567 589 N/A INTRINSIC
low complexity region 593 679 N/A INTRINSIC
low complexity region 680 705 N/A INTRINSIC
low complexity region 719 748 N/A INTRINSIC
low complexity region 749 768 N/A INTRINSIC
low complexity region 772 800 N/A INTRINSIC
internal_repeat_5 804 825 4.17e-5 PROSPERO
internal_repeat_3 810 836 6.93e-6 PROSPERO
low complexity region 846 860 N/A INTRINSIC
low complexity region 863 885 N/A INTRINSIC
internal_repeat_5 895 919 4.17e-5 PROSPERO
internal_repeat_4 899 939 1.7e-5 PROSPERO
internal_repeat_1 944 1461 8.08e-127 PROSPERO
internal_repeat_6 1335 1386 4.17e-5 PROSPERO
low complexity region 1465 1485 N/A INTRINSIC
internal_repeat_1 1486 2009 8.08e-127 PROSPERO
internal_repeat_4 2123 2173 1.7e-5 PROSPERO
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 100% (62/62)
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrb3 T A 1: 25,532,630 Q402L probably benign Het
Afap1l1 T C 18: 61,736,846 T638A probably benign Het
Agtr1a A C 13: 30,381,907 K318N possibly damaging Het
Anks1b A G 10: 90,941,432 T1095A probably damaging Het
Ap3d1 A T 10: 80,723,803 I207N probably damaging Het
Arhgef11 T C 3: 87,713,292 L484P possibly damaging Het
Astn2 C T 4: 65,542,669 S1076N probably benign Het
Baat C A 4: 49,490,213 L290F probably benign Het
Boll T C 1: 55,304,598 Y222C probably damaging Het
Bphl A T 13: 34,050,341 I147F possibly damaging Het
C330027C09Rik T A 16: 49,005,821 M417K probably benign Het
Cadps2 T G 6: 23,409,935 D766A unknown Het
Cd300lb T A 11: 114,925,032 K210M probably damaging Het
Cdan1 T C 2: 120,724,704 Q797R probably benign Het
Celsr1 T A 15: 86,033,008 S255C probably damaging Het
Csmd1 G A 8: 16,058,707 S1894L probably damaging Het
Dennd5b T A 6: 149,020,570 K815N probably benign Het
Exd1 A G 2: 119,520,139 V547A probably benign Het
Fbxo15 C T 18: 84,959,118 R52C probably damaging Het
Fip1l1 A G 5: 74,536,799 probably null Het
Fyttd1 T A 16: 32,884,248 N76K probably benign Het
Gins1 T A 2: 150,916,166 D57E probably benign Het
Gm5565 G C 5: 146,158,361 probably null Het
Gm6614 T C 6: 141,989,225 K379E probably damaging Het
Gpsm2 T C 3: 108,702,928 Y72C probably damaging Het
Hace1 C A 10: 45,589,507 S53* probably null Het
Insig2 A G 1: 121,306,937 V188A possibly damaging Het
Ism1 T C 2: 139,757,043 V312A probably damaging Het
Jmy A T 13: 93,472,743 Y353N probably damaging Het
Maats1 T A 16: 38,321,601 probably null Het
Maz A C 7: 127,025,553 V265G probably benign Het
Mtmr14 T A 6: 113,269,548 I426N probably damaging Het
Olfr1054 A G 2: 86,333,000 S119P possibly damaging Het
Olfr1467 A G 19: 13,364,637 E3G probably benign Het
Olfr394 C T 11: 73,888,275 M32I probably benign Het
Pcdhac2 T A 18: 37,145,360 N464K probably damaging Het
Pcdhb7 T A 18: 37,343,387 H525Q probably benign Het
Pcp4l1 G A 1: 171,174,465 A42V possibly damaging Het
Podn C T 4: 108,017,702 probably null Het
Prim1 A G 10: 128,022,919 D232G probably null Het
Prrt1 T A 17: 34,632,187 M283K possibly damaging Het
Rgs9 A T 11: 109,276,581 I65N probably damaging Het
Scgb2b26 C A 7: 33,944,357 V53L probably benign Het
Shank2 C A 7: 144,411,685 P1010Q probably benign Het
Slc12a4 C T 8: 105,955,715 G121S probably damaging Het
Slc17a6 G T 7: 51,645,018 A158S probably damaging Het
Slc9a9 C T 9: 94,712,898 H154Y probably benign Het
Slco2a1 T A 9: 103,085,749 probably null Het
Snapc3 T C 4: 83,435,270 I182T probably benign Het
Taok2 A G 7: 126,871,088 V856A probably benign Het
Tep1 T A 14: 50,866,038 N265I probably damaging Het
Tespa1 A T 10: 130,362,041 N311Y probably damaging Het
Tpmt G A 13: 47,041,484 Q14* probably null Het
Trim33 T C 3: 103,321,636 F353L possibly damaging Het
Upp1 T C 11: 9,134,743 V154A probably damaging Het
Usp34 T C 11: 23,419,052 I1747T Het
Vmn1r47 T C 6: 90,022,272 S129P probably benign Het
Vmn2r93 A G 17: 18,303,987 Y81C probably benign Het
Ybx2 A T 11: 69,940,355 T259S probably benign Het
Zfp536 T C 7: 37,479,860 T1107A probably benign Het
Zfp583 C T 7: 6,316,586 A476T probably damaging Het
Other mutations in Flg2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00090:Flg2 APN 3 93202109 nonsense probably null
IGL00092:Flg2 APN 3 93219855 missense possibly damaging 0.90
IGL00985:Flg2 APN 3 93203278 missense unknown
IGL01077:Flg2 APN 3 93220206 missense unknown
IGL01093:Flg2 APN 3 93202371 missense unknown
IGL01120:Flg2 APN 3 93201168 missense probably damaging 0.99
IGL01473:Flg2 APN 3 93203020 missense unknown
IGL01584:Flg2 APN 3 93213466 missense unknown
IGL01584:Flg2 APN 3 93215470 missense unknown
IGL01686:Flg2 APN 3 93202284 missense unknown
IGL02207:Flg2 APN 3 93220128 missense unknown
IGL02294:Flg2 APN 3 93203746 missense unknown
IGL02418:Flg2 APN 3 93201054 missense probably benign 0.26
IGL02581:Flg2 APN 3 93219892 missense unknown
IGL02719:Flg2 APN 3 93220131 nonsense probably null
IGL02795:Flg2 APN 3 93203613 missense unknown
IGL02893:Flg2 APN 3 93203613 missense unknown
IGL02958:Flg2 APN 3 93203613 missense unknown
IGL03060:Flg2 APN 3 93203613 missense unknown
IGL03088:Flg2 APN 3 93203191 missense unknown
IGL03165:Flg2 APN 3 93214611 missense unknown
IGL03342:Flg2 APN 3 93201235 missense probably damaging 1.00
IGL03352:Flg2 APN 3 93202494 missense unknown
IGL02796:Flg2 UTSW 3 93203613 missense unknown
IGL02837:Flg2 UTSW 3 93201737 missense probably damaging 1.00
PIT4618001:Flg2 UTSW 3 93203781 missense unknown
R0087:Flg2 UTSW 3 93202431 missense unknown
R0233:Flg2 UTSW 3 93201797 nonsense probably null
R0233:Flg2 UTSW 3 93201797 nonsense probably null
R0315:Flg2 UTSW 3 93214722 missense unknown
R0390:Flg2 UTSW 3 93200355 splice site probably benign
R0462:Flg2 UTSW 3 93201437 missense probably benign 0.18
R0553:Flg2 UTSW 3 93203584 missense unknown
R0828:Flg2 UTSW 3 93203332 missense unknown
R1006:Flg2 UTSW 3 93201207 missense probably benign 0.41
R1444:Flg2 UTSW 3 93202313 missense unknown
R1497:Flg2 UTSW 3 93219769 missense unknown
R1518:Flg2 UTSW 3 93203138 missense unknown
R1737:Flg2 UTSW 3 93203621 missense unknown
R1780:Flg2 UTSW 3 93202999 missense unknown
R1797:Flg2 UTSW 3 93200976 missense probably damaging 1.00
R2065:Flg2 UTSW 3 93202231 missense unknown
R2168:Flg2 UTSW 3 93201937 missense probably damaging 1.00
R2220:Flg2 UTSW 3 93202185 missense unknown
R2292:Flg2 UTSW 3 93220677 missense unknown
R2327:Flg2 UTSW 3 93203606 nonsense probably null
R2512:Flg2 UTSW 3 93201775 missense probably damaging 1.00
R3177:Flg2 UTSW 3 93214888 missense unknown
R3277:Flg2 UTSW 3 93214888 missense unknown
R3522:Flg2 UTSW 3 93220027 missense unknown
R3779:Flg2 UTSW 3 93202423 missense unknown
R3926:Flg2 UTSW 3 93203215 missense unknown
R4082:Flg2 UTSW 3 93203521 missense unknown
R4407:Flg2 UTSW 3 93214869 missense unknown
R5152:Flg2 UTSW 3 93214977 missense unknown
R5253:Flg2 UTSW 3 93200812 missense probably damaging 1.00
R5290:Flg2 UTSW 3 93220566 missense unknown
R5464:Flg2 UTSW 3 93201970 missense possibly damaging 0.73
R5539:Flg2 UTSW 3 93220446 missense unknown
R5622:Flg2 UTSW 3 93202564 missense unknown
R5788:Flg2 UTSW 3 93200989 missense probably benign 0.41
R5792:Flg2 UTSW 3 93203497 missense unknown
R5831:Flg2 UTSW 3 93200234 missense probably damaging 1.00
R5877:Flg2 UTSW 3 93203449 missense unknown
R6041:Flg2 UTSW 3 93220361 missense probably benign 0.01
R6189:Flg2 UTSW 3 93220074 missense unknown
R6214:Flg2 UTSW 3 93201859 missense possibly damaging 0.83
R6215:Flg2 UTSW 3 93201859 missense possibly damaging 0.83
R6239:Flg2 UTSW 3 93201272 missense probably benign 0.36
R6288:Flg2 UTSW 3 93203785 missense unknown
R6413:Flg2 UTSW 3 93220376 missense unknown
R6457:Flg2 UTSW 3 93220482 missense unknown
R6468:Flg2 UTSW 3 93214421 missense unknown
R6667:Flg2 UTSW 3 93201761 missense possibly damaging 0.88
R6930:Flg2 UTSW 3 93201335 nonsense probably null
R6996:Flg2 UTSW 3 93202670 missense unknown
R6996:Flg2 UTSW 3 93202949 missense unknown
R7100:Flg2 UTSW 3 93203711 missense unknown
R7133:Flg2 UTSW 3 93219762 missense unknown
R7180:Flg2 UTSW 3 93202833 missense unknown
R7349:Flg2 UTSW 3 93220206 missense unknown
R7531:Flg2 UTSW 3 93200870 missense probably damaging 0.99
R7571:Flg2 UTSW 3 93219996 nonsense probably null
R7684:Flg2 UTSW 3 93219649 missense unknown
Predicted Primers PCR Primer
(F):5'- GTCATTGGGATTTGGACAGC -3'
(R):5'- TCCAGAATATCTCCGTGGGAC -3'

Sequencing Primer
(F):5'- GGGATCTCATCAGTCAGAAAGTTC -3'
(R):5'- CAGAATATCTCCGTGGGACTACTG -3'
Posted On2019-09-13