Incidental Mutation 'R7325:Gpsm2'
ID568806
Institutional Source Beutler Lab
Gene Symbol Gpsm2
Ensembl Gene ENSMUSG00000027883
Gene NameG-protein signalling modulator 2 (AGS3-like, C. elegans)
SynonymsLGN, 6230410J09Rik, Pins
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.328) question?
Stock #R7325 (G1)
Quality Score225.009
Status Validated
Chromosome3
Chromosomal Location108678638-108722309 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 108702928 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 72 (Y72C)
Ref Sequence ENSEMBL: ENSMUSP00000029482 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029482] [ENSMUST00000145558]
PDB Structure
Structures of the LGN/NuMA complex [X-RAY DIFFRACTION]
crystal structure of LGN/mInscuteable complex [X-RAY DIFFRACTION]
Structure complex of LGN binding with FRMPD1 [X-RAY DIFFRACTION]
Structure of LGN GL4/Galphai3(Q147L) complex [X-RAY DIFFRACTION]
Structure of LGN GL4/Galphai1 complex [X-RAY DIFFRACTION]
Structure of LGN GL4/Galphai3 complex [X-RAY DIFFRACTION]
Structure of LGN GL3/Galphai3 complex [X-RAY DIFFRACTION]
An auto-inhibited conformation of LGN reveals a distinct interaction mode between GoLoco motifs and TPR motifs [X-RAY DIFFRACTION]
Predicted Effect probably damaging
Transcript: ENSMUST00000029482
AA Change: Y72C

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000029482
Gene: ENSMUSG00000027883
AA Change: Y72C

DomainStartEndE-ValueType
TPR 62 95 7.86e-3 SMART
TPR 102 135 4.34e-5 SMART
Blast:TPR 142 188 9e-22 BLAST
TPR 202 235 1.69e-2 SMART
TPR 242 275 3.99e-4 SMART
TPR 282 315 1.51e-4 SMART
TPR 322 355 1.04e-2 SMART
GoLoco 490 512 3.69e-9 SMART
low complexity region 518 527 N/A INTRINSIC
GoLoco 543 565 7.27e-8 SMART
GoLoco 594 616 2.31e-10 SMART
GoLoco 628 650 2.75e-8 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000145558
AA Change: Y72C

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000115759
Gene: ENSMUSG00000027883
AA Change: Y72C

DomainStartEndE-ValueType
Blast:TPR 24 57 1e-10 BLAST
Pfam:TPR_8 61 84 1.5e-2 PFAM
Pfam:TPR_10 61 101 3.6e-5 PFAM
Pfam:TPR_1 62 86 7.6e-6 PFAM
Pfam:TPR_2 62 94 2e-5 PFAM
Pfam:TPR_7 64 99 1e-4 PFAM
Pfam:TPR_12 101 154 4.6e-10 PFAM
Pfam:TPR_2 102 134 7e-4 PFAM
Pfam:TPR_1 102 135 2.2e-8 PFAM
Pfam:TPR_8 102 136 5.8e-3 PFAM
Pfam:TPR_7 104 139 4.3e-4 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 100% (62/62)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to a family of proteins that modulate activation of G proteins, which transduce extracellular signals received by cell surface receptors into integrated cellular responses. The N-terminal half of this protein contains 10 copies of leu-gly-asn (LGN) repeat, and the C-terminal half contains 4 GoLoco motifs, which are involved in guanine nucleotide exchange. This protein may play a role in neuroblast division and in the development of normal hearing. Mutations in this gene are associated with autosomal recessive nonsyndromic deafness (DFNB82). Alternative splicing results in multiple transcript variants. [provided by RefSeq, Mar 2016]
PHENOTYPE: Targeted disruption of this gene randomizes the spindle orientation of normally planar neuroepithelial divisions. The ensuing loss of the apical membrane from daughter cells frequently converts them into abnormally localized progenitors with no apparent effect on neuronal production. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrb3 T A 1: 25,532,630 Q402L probably benign Het
Afap1l1 T C 18: 61,736,846 T638A probably benign Het
Agtr1a A C 13: 30,381,907 K318N possibly damaging Het
Anks1b A G 10: 90,941,432 T1095A probably damaging Het
Ap3d1 A T 10: 80,723,803 I207N probably damaging Het
Arhgef11 T C 3: 87,713,292 L484P possibly damaging Het
Astn2 C T 4: 65,542,669 S1076N probably benign Het
Baat C A 4: 49,490,213 L290F probably benign Het
Boll T C 1: 55,304,598 Y222C probably damaging Het
Bphl A T 13: 34,050,341 I147F possibly damaging Het
C330027C09Rik T A 16: 49,005,821 M417K probably benign Het
Cadps2 T G 6: 23,409,935 D766A unknown Het
Cd300lb T A 11: 114,925,032 K210M probably damaging Het
Cdan1 T C 2: 120,724,704 Q797R probably benign Het
Celsr1 T A 15: 86,033,008 S255C probably damaging Het
Csmd1 G A 8: 16,058,707 S1894L probably damaging Het
Dennd5b T A 6: 149,020,570 K815N probably benign Het
Exd1 A G 2: 119,520,139 V547A probably benign Het
Fbxo15 C T 18: 84,959,118 R52C probably damaging Het
Fip1l1 A G 5: 74,536,799 probably null Het
Flg2 T A 3: 93,203,372 N902K unknown Het
Fyttd1 T A 16: 32,884,248 N76K probably benign Het
Gins1 T A 2: 150,916,166 D57E probably benign Het
Gm5565 G C 5: 146,158,361 probably null Het
Gm6614 T C 6: 141,989,225 K379E probably damaging Het
Hace1 C A 10: 45,589,507 S53* probably null Het
Insig2 A G 1: 121,306,937 V188A possibly damaging Het
Ism1 T C 2: 139,757,043 V312A probably damaging Het
Jmy A T 13: 93,472,743 Y353N probably damaging Het
Maats1 T A 16: 38,321,601 probably null Het
Maz A C 7: 127,025,553 V265G probably benign Het
Mtmr14 T A 6: 113,269,548 I426N probably damaging Het
Olfr1054 A G 2: 86,333,000 S119P possibly damaging Het
Olfr1467 A G 19: 13,364,637 E3G probably benign Het
Olfr394 C T 11: 73,888,275 M32I probably benign Het
Pcdhac2 T A 18: 37,145,360 N464K probably damaging Het
Pcdhb7 T A 18: 37,343,387 H525Q probably benign Het
Pcp4l1 G A 1: 171,174,465 A42V possibly damaging Het
Podn C T 4: 108,017,702 probably null Het
Prim1 A G 10: 128,022,919 D232G probably null Het
Prrt1 T A 17: 34,632,187 M283K possibly damaging Het
Rgs9 A T 11: 109,276,581 I65N probably damaging Het
Scgb2b26 C A 7: 33,944,357 V53L probably benign Het
Shank2 C A 7: 144,411,685 P1010Q probably benign Het
Slc12a4 C T 8: 105,955,715 G121S probably damaging Het
Slc17a6 G T 7: 51,645,018 A158S probably damaging Het
Slc9a9 C T 9: 94,712,898 H154Y probably benign Het
Slco2a1 T A 9: 103,085,749 probably null Het
Snapc3 T C 4: 83,435,270 I182T probably benign Het
Taok2 A G 7: 126,871,088 V856A probably benign Het
Tep1 T A 14: 50,866,038 N265I probably damaging Het
Tespa1 A T 10: 130,362,041 N311Y probably damaging Het
Tpmt G A 13: 47,041,484 Q14* probably null Het
Trim33 T C 3: 103,321,636 F353L possibly damaging Het
Upp1 T C 11: 9,134,743 V154A probably damaging Het
Usp34 T C 11: 23,419,052 I1747T Het
Vmn1r47 T C 6: 90,022,272 S129P probably benign Het
Vmn2r93 A G 17: 18,303,987 Y81C probably benign Het
Ybx2 A T 11: 69,940,355 T259S probably benign Het
Zfp536 T C 7: 37,479,860 T1107A probably benign Het
Zfp583 C T 7: 6,316,586 A476T probably damaging Het
Other mutations in Gpsm2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01597:Gpsm2 APN 3 108696987 missense probably benign 0.00
IGL01754:Gpsm2 APN 3 108703045 missense probably damaging 1.00
IGL02624:Gpsm2 APN 3 108682033 missense probably benign 0.01
IGL03005:Gpsm2 APN 3 108687006 splice site probably benign
R0482:Gpsm2 UTSW 3 108702394 splice site probably benign
R1793:Gpsm2 UTSW 3 108700909 missense probably benign 0.14
R1796:Gpsm2 UTSW 3 108701850 missense probably damaging 0.99
R4174:Gpsm2 UTSW 3 108702509 missense probably damaging 1.00
R7048:Gpsm2 UTSW 3 108703045 missense probably damaging 1.00
R7400:Gpsm2 UTSW 3 108679688 missense probably damaging 1.00
R7574:Gpsm2 UTSW 3 108700745 missense probably damaging 0.98
R7657:Gpsm2 UTSW 3 108700745 missense probably damaging 0.98
R7709:Gpsm2 UTSW 3 108701781 missense probably benign 0.08
Z1088:Gpsm2 UTSW 3 108700760 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGTTGCTCCATTACTAGTTTGC -3'
(R):5'- CTGATCCAGTTGTAATGTGTCTGTC -3'

Sequencing Primer
(F):5'- GCTCCATTACTAGTTTGCCTAAAAG -3'
(R):5'- TGTGTCTGTCATATATAATTCTGCAG -3'
Posted On2019-09-13