Incidental Mutation 'R7325:Baat'
ID568807
Institutional Source Beutler Lab
Gene Symbol Baat
Ensembl Gene ENSMUSG00000039653
Gene Namebile acid-Coenzyme A: amino acid N-acyltransferase
Synonymstaurine N-acyltransferase, BAT
Accession Numbers

Genbank: NM_007519; MGI: 106642

 

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7325 (G1)
Quality Score225.009
Status Validated
Chromosome4
Chromosomal Location49489422-49506557 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 49490213 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Phenylalanine at position 290 (L290F)
Ref Sequence ENSEMBL: ENSMUSP00000041983 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000043056] [ENSMUST00000166036]
Predicted Effect probably benign
Transcript: ENSMUST00000043056
AA Change: L290F

PolyPhen 2 Score 0.070 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000041983
Gene: ENSMUSG00000039653
AA Change: L290F

DomainStartEndE-ValueType
Pfam:Bile_Hydr_Trans 13 145 1.7e-44 PFAM
low complexity region 149 162 N/A INTRINSIC
Pfam:BAAT_C 206 414 8.1e-77 PFAM
Pfam:DLH 285 412 5.5e-7 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000166036
AA Change: L290F

PolyPhen 2 Score 0.070 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000129603
Gene: ENSMUSG00000039653
AA Change: L290F

DomainStartEndE-ValueType
Pfam:Bile_Hydr_Trans 14 144 5.1e-45 PFAM
low complexity region 149 162 N/A INTRINSIC
Pfam:BAAT_C 206 414 1.2e-77 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 100% (62/62)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a liver enzyme that catalyzes the transfer of C24 bile acids from the acyl-CoA thioester to either glycine or taurine, the second step in the formation of bile acid-amino acid conjugates. The bile acid conjugates then act as a detergent in the gastrointestinal tract, which enhances lipid and fat-soluble vitamin absorption. Defects in this gene are a cause of familial hypercholanemia (FHCA). Two transcript variants encoding the same protein have been found for this gene. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrb3 T A 1: 25,532,630 Q402L probably benign Het
Afap1l1 T C 18: 61,736,846 T638A probably benign Het
Agtr1a A C 13: 30,381,907 K318N possibly damaging Het
Anks1b A G 10: 90,941,432 T1095A probably damaging Het
Ap3d1 A T 10: 80,723,803 I207N probably damaging Het
Arhgef11 T C 3: 87,713,292 L484P possibly damaging Het
Astn2 C T 4: 65,542,669 S1076N probably benign Het
Boll T C 1: 55,304,598 Y222C probably damaging Het
Bphl A T 13: 34,050,341 I147F possibly damaging Het
C330027C09Rik T A 16: 49,005,821 M417K probably benign Het
Cadps2 T G 6: 23,409,935 D766A unknown Het
Cd300lb T A 11: 114,925,032 K210M probably damaging Het
Cdan1 T C 2: 120,724,704 Q797R probably benign Het
Celsr1 T A 15: 86,033,008 S255C probably damaging Het
Csmd1 G A 8: 16,058,707 S1894L probably damaging Het
Dennd5b T A 6: 149,020,570 K815N probably benign Het
Exd1 A G 2: 119,520,139 V547A probably benign Het
Fbxo15 C T 18: 84,959,118 R52C probably damaging Het
Fip1l1 A G 5: 74,536,799 probably null Het
Flg2 T A 3: 93,203,372 N902K unknown Het
Fyttd1 T A 16: 32,884,248 N76K probably benign Het
Gins1 T A 2: 150,916,166 D57E probably benign Het
Gm5565 G C 5: 146,158,361 probably null Het
Gm6614 T C 6: 141,989,225 K379E probably damaging Het
Gpsm2 T C 3: 108,702,928 Y72C probably damaging Het
Hace1 C A 10: 45,589,507 S53* probably null Het
Insig2 A G 1: 121,306,937 V188A possibly damaging Het
Ism1 T C 2: 139,757,043 V312A probably damaging Het
Jmy A T 13: 93,472,743 Y353N probably damaging Het
Maats1 T A 16: 38,321,601 probably null Het
Maz A C 7: 127,025,553 V265G probably benign Het
Mtmr14 T A 6: 113,269,548 I426N probably damaging Het
Olfr1054 A G 2: 86,333,000 S119P possibly damaging Het
Olfr1467 A G 19: 13,364,637 E3G probably benign Het
Olfr394 C T 11: 73,888,275 M32I probably benign Het
Pcdhac2 T A 18: 37,145,360 N464K probably damaging Het
Pcdhb7 T A 18: 37,343,387 H525Q probably benign Het
Pcp4l1 G A 1: 171,174,465 A42V possibly damaging Het
Podn C T 4: 108,017,702 probably null Het
Prim1 A G 10: 128,022,919 D232G probably null Het
Prrt1 T A 17: 34,632,187 M283K possibly damaging Het
Rgs9 A T 11: 109,276,581 I65N probably damaging Het
Scgb2b26 C A 7: 33,944,357 V53L probably benign Het
Shank2 C A 7: 144,411,685 P1010Q probably benign Het
Slc12a4 C T 8: 105,955,715 G121S probably damaging Het
Slc17a6 G T 7: 51,645,018 A158S probably damaging Het
Slc9a9 C T 9: 94,712,898 H154Y probably benign Het
Slco2a1 T A 9: 103,085,749 probably null Het
Snapc3 T C 4: 83,435,270 I182T probably benign Het
Taok2 A G 7: 126,871,088 V856A probably benign Het
Tep1 T A 14: 50,866,038 N265I probably damaging Het
Tespa1 A T 10: 130,362,041 N311Y probably damaging Het
Tpmt G A 13: 47,041,484 Q14* probably null Het
Trim33 T C 3: 103,321,636 F353L possibly damaging Het
Upp1 T C 11: 9,134,743 V154A probably damaging Het
Usp34 T C 11: 23,419,052 I1747T Het
Vmn1r47 T C 6: 90,022,272 S129P probably benign Het
Vmn2r93 A G 17: 18,303,987 Y81C probably benign Het
Ybx2 A T 11: 69,940,355 T259S probably benign Het
Zfp536 T C 7: 37,479,860 T1107A probably benign Het
Zfp583 C T 7: 6,316,586 A476T probably damaging Het
Other mutations in Baat
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00838:Baat APN 4 49490352 missense probably damaging 1.00
IGL01124:Baat APN 4 49490391 missense possibly damaging 0.82
IGL01327:Baat APN 4 49490338 missense probably damaging 1.00
IGL02394:Baat APN 4 49489812 unclassified probably benign
IGL03267:Baat APN 4 49490050 missense probably benign 0.00
R0085:Baat UTSW 4 49490425 splice site probably benign
R1467:Baat UTSW 4 49503101 missense probably benign
R1467:Baat UTSW 4 49503101 missense probably benign
R1720:Baat UTSW 4 49490231 missense probably benign
R2309:Baat UTSW 4 49499718 missense probably damaging 1.00
R2992:Baat UTSW 4 49499675 nonsense probably null
R4383:Baat UTSW 4 49499731 missense probably damaging 1.00
R4602:Baat UTSW 4 49502727 missense probably damaging 1.00
R5190:Baat UTSW 4 49499652 missense probably damaging 1.00
R5259:Baat UTSW 4 49490070 missense probably benign 0.08
R5456:Baat UTSW 4 49502949 missense possibly damaging 0.91
R5988:Baat UTSW 4 49502871 missense probably damaging 1.00
R6265:Baat UTSW 4 49502836 missense possibly damaging 0.94
R7091:Baat UTSW 4 49499692 missense probably benign 0.00
R7209:Baat UTSW 4 49503065 missense probably damaging 1.00
R7295:Baat UTSW 4 49490275 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TAGGGAGGCTCAATCAGGTG -3'
(R):5'- TGCATTGGAGCAGAGATTGG -3'

Sequencing Primer
(F):5'- GGTAAGACAGCAGAGTCCAATTCTTC -3'
(R):5'- CATTGGAGCAGAGATTGGACTTTC -3'
Posted On2019-09-13