Incidental Mutation 'R7325:Mtmr14'
ID568813
Institutional Source Beutler Lab
Gene Symbol Mtmr14
Ensembl Gene ENSMUSG00000030269
Gene Namemyotubularin related protein 14
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.167) question?
Stock #R7325 (G1)
Quality Score225.009
Status Validated
Chromosome6
Chromosomal Location113237843-113281392 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 113269548 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Asparagine at position 426 (I426N)
Ref Sequence ENSEMBL: ENSMUSP00000108771 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000113146] [ENSMUST00000129883] [ENSMUST00000134945] [ENSMUST00000142938] [ENSMUST00000203385]
Predicted Effect probably damaging
Transcript: ENSMUST00000113146
AA Change: I426N

PolyPhen 2 Score 0.977 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000108771
Gene: ENSMUSG00000030269
AA Change: I426N

DomainStartEndE-ValueType
low complexity region 2 20 N/A INTRINSIC
Blast:C2 605 647 2e-10 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000129883
SMART Domains Protein: ENSMUSP00000114575
Gene: ENSMUSG00000030269

DomainStartEndE-ValueType
low complexity region 2 20 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000134945
AA Change: I94N

PolyPhen 2 Score 0.104 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000118001
Gene: ENSMUSG00000030269
AA Change: I94N

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
Blast:C2 221 256 3e-10 BLAST
Predicted Effect
SMART Domains Protein: ENSMUSP00000119000
Gene: ENSMUSG00000030269
AA Change: I139N

DomainStartEndE-ValueType
Pfam:Myotub-related 10 231 5.7e-8 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000142938
SMART Domains Protein: ENSMUSP00000121136
Gene: ENSMUSG00000030269

DomainStartEndE-ValueType
low complexity region 2 20 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000144976
Predicted Effect probably benign
Transcript: ENSMUST00000148523
SMART Domains Protein: ENSMUSP00000115808
Gene: ENSMUSG00000030269

DomainStartEndE-ValueType
Pfam:Myotub-related 1 102 4.2e-8 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000151149
Predicted Effect probably benign
Transcript: ENSMUST00000203385
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 100% (62/62)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a myotubularin-related protein. The encoded protein is a phosphoinositide phosphatase that specifically dephosphorylates phosphatidylinositol 3,5-biphosphate and phosphatidylinositol 3-phosphate. Mutations in this gene are correlated with autosomal dominant centronuclear myopathy. Alternate splicing results in multiple transcript variants. A pseudogene of this gene is found on chromosome 18.[provided by RefSeq, Apr 2010]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit impaired coordination, decreased exercise endurance, increased muscle fatigue, and muscle atrophy associated with impaired muscular calcium homeostasis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrb3 T A 1: 25,532,630 Q402L probably benign Het
Afap1l1 T C 18: 61,736,846 T638A probably benign Het
Agtr1a A C 13: 30,381,907 K318N possibly damaging Het
Anks1b A G 10: 90,941,432 T1095A probably damaging Het
Ap3d1 A T 10: 80,723,803 I207N probably damaging Het
Arhgef11 T C 3: 87,713,292 L484P possibly damaging Het
Astn2 C T 4: 65,542,669 S1076N probably benign Het
Baat C A 4: 49,490,213 L290F probably benign Het
Boll T C 1: 55,304,598 Y222C probably damaging Het
Bphl A T 13: 34,050,341 I147F possibly damaging Het
C330027C09Rik T A 16: 49,005,821 M417K probably benign Het
Cadps2 T G 6: 23,409,935 D766A unknown Het
Cd300lb T A 11: 114,925,032 K210M probably damaging Het
Cdan1 T C 2: 120,724,704 Q797R probably benign Het
Celsr1 T A 15: 86,033,008 S255C probably damaging Het
Csmd1 G A 8: 16,058,707 S1894L probably damaging Het
Dennd5b T A 6: 149,020,570 K815N probably benign Het
Exd1 A G 2: 119,520,139 V547A probably benign Het
Fbxo15 C T 18: 84,959,118 R52C probably damaging Het
Fip1l1 A G 5: 74,536,799 probably null Het
Flg2 T A 3: 93,203,372 N902K unknown Het
Fyttd1 T A 16: 32,884,248 N76K probably benign Het
Gins1 T A 2: 150,916,166 D57E probably benign Het
Gm5565 G C 5: 146,158,361 probably null Het
Gm6614 T C 6: 141,989,225 K379E probably damaging Het
Gpsm2 T C 3: 108,702,928 Y72C probably damaging Het
Hace1 C A 10: 45,589,507 S53* probably null Het
Insig2 A G 1: 121,306,937 V188A possibly damaging Het
Ism1 T C 2: 139,757,043 V312A probably damaging Het
Jmy A T 13: 93,472,743 Y353N probably damaging Het
Maats1 T A 16: 38,321,601 probably null Het
Maz A C 7: 127,025,553 V265G probably benign Het
Olfr1054 A G 2: 86,333,000 S119P possibly damaging Het
Olfr1467 A G 19: 13,364,637 E3G probably benign Het
Olfr394 C T 11: 73,888,275 M32I probably benign Het
Pcdhac2 T A 18: 37,145,360 N464K probably damaging Het
Pcdhb7 T A 18: 37,343,387 H525Q probably benign Het
Pcp4l1 G A 1: 171,174,465 A42V possibly damaging Het
Podn C T 4: 108,017,702 probably null Het
Prim1 A G 10: 128,022,919 D232G probably null Het
Prrt1 T A 17: 34,632,187 M283K possibly damaging Het
Rgs9 A T 11: 109,276,581 I65N probably damaging Het
Scgb2b26 C A 7: 33,944,357 V53L probably benign Het
Shank2 C A 7: 144,411,685 P1010Q probably benign Het
Slc12a4 C T 8: 105,955,715 G121S probably damaging Het
Slc17a6 G T 7: 51,645,018 A158S probably damaging Het
Slc9a9 C T 9: 94,712,898 H154Y probably benign Het
Slco2a1 T A 9: 103,085,749 probably null Het
Snapc3 T C 4: 83,435,270 I182T probably benign Het
Taok2 A G 7: 126,871,088 V856A probably benign Het
Tep1 T A 14: 50,866,038 N265I probably damaging Het
Tespa1 A T 10: 130,362,041 N311Y probably damaging Het
Tpmt G A 13: 47,041,484 Q14* probably null Het
Trim33 T C 3: 103,321,636 F353L possibly damaging Het
Upp1 T C 11: 9,134,743 V154A probably damaging Het
Usp34 T C 11: 23,419,052 I1747T Het
Vmn1r47 T C 6: 90,022,272 S129P probably benign Het
Vmn2r93 A G 17: 18,303,987 Y81C probably benign Het
Ybx2 A T 11: 69,940,355 T259S probably benign Het
Zfp536 T C 7: 37,479,860 T1107A probably benign Het
Zfp583 C T 7: 6,316,586 A476T probably damaging Het
Other mutations in Mtmr14
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01063:Mtmr14 APN 6 113266326 missense probably damaging 0.98
IGL01686:Mtmr14 APN 6 113240430 missense possibly damaging 0.58
IGL02508:Mtmr14 APN 6 113240306 missense probably damaging 1.00
R0147:Mtmr14 UTSW 6 113260666 splice site probably benign
R0394:Mtmr14 UTSW 6 113280688 nonsense probably null
R0529:Mtmr14 UTSW 6 113266252 unclassified probably benign
R0675:Mtmr14 UTSW 6 113270647 missense probably damaging 0.99
R0723:Mtmr14 UTSW 6 113270512 unclassified probably benign
R0785:Mtmr14 UTSW 6 113277947 critical splice donor site probably null
R0866:Mtmr14 UTSW 6 113239582 critical splice donor site probably null
R1721:Mtmr14 UTSW 6 113253732 missense probably damaging 1.00
R1998:Mtmr14 UTSW 6 113277924 missense probably null
R2063:Mtmr14 UTSW 6 113240361 missense probably damaging 1.00
R2192:Mtmr14 UTSW 6 113280739 missense probably damaging 1.00
R2656:Mtmr14 UTSW 6 113240366 missense probably benign 0.03
R4648:Mtmr14 UTSW 6 113260606 missense probably benign 0.12
R5209:Mtmr14 UTSW 6 113253775 nonsense probably null
R5509:Mtmr14 UTSW 6 113253807 critical splice donor site probably null
R5569:Mtmr14 UTSW 6 113240285 missense probably damaging 0.96
R5589:Mtmr14 UTSW 6 113261282 critical splice donor site probably null
R5924:Mtmr14 UTSW 6 113253789 missense probably damaging 1.00
R5997:Mtmr14 UTSW 6 113280614 missense probably damaging 0.97
R6182:Mtmr14 UTSW 6 113269508 missense possibly damaging 0.78
R6658:Mtmr14 UTSW 6 113265476 nonsense probably null
R6752:Mtmr14 UTSW 6 113240397 missense probably damaging 1.00
R7512:Mtmr14 UTSW 6 113268691 nonsense probably null
R7816:Mtmr14 UTSW 6 113266302 missense probably damaging 1.00
X0023:Mtmr14 UTSW 6 113261255 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCCAAACTGGTAGATCCTGGAAG -3'
(R):5'- GCAGCAGAAAGTCAGCATGC -3'

Sequencing Primer
(F):5'- TAGATCCTGGAAGTGGGCC -3'
(R):5'- GCAGAAAGTCAGCATGCTACCTTC -3'
Posted On2019-09-13