Incidental Mutation 'R7325:Maz'
ID568821
Institutional Source Beutler Lab
Gene Symbol Maz
Ensembl Gene ENSMUSG00000030678
Gene NameMYC-associated zinc finger protein (purine-binding transcription factor)
SynonymsSAF-2, Pur-1, PUR1, SAF-1
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.477) question?
Stock #R7325 (G1)
Quality Score225.009
Status Validated
Chromosome7
Chromosomal Location127022130-127027037 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 127025553 bp
ZygosityHeterozygous
Amino Acid Change Valine to Glycine at position 265 (V265G)
Ref Sequence ENSEMBL: ENSMUSP00000032916 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032915] [ENSMUST00000032916] [ENSMUST00000159916] [ENSMUST00000202045] [ENSMUST00000202624] [ENSMUST00000205461] [ENSMUST00000205568] [ENSMUST00000206254] [ENSMUST00000206291]
Predicted Effect probably benign
Transcript: ENSMUST00000032915
SMART Domains Protein: ENSMUSP00000032915
Gene: ENSMUSG00000030677

DomainStartEndE-ValueType
KISc 36 371 1.12e-140 SMART
low complexity region 399 428 N/A INTRINSIC
coiled coil region 460 496 N/A INTRINSIC
HhH1 597 616 2.16e0 SMART
HhH1 627 646 8.65e0 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000032916
AA Change: V265G

PolyPhen 2 Score 0.346 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000032916
Gene: ENSMUSG00000030678
AA Change: V265G

DomainStartEndE-ValueType
low complexity region 59 82 N/A INTRINSIC
low complexity region 90 126 N/A INTRINSIC
low complexity region 130 179 N/A INTRINSIC
ZnF_C2H2 190 212 4.11e-2 SMART
low complexity region 231 272 N/A INTRINSIC
ZnF_C2H2 279 301 6.78e-3 SMART
ZnF_C2H2 307 329 4.87e-4 SMART
ZnF_C2H2 337 360 1.22e-4 SMART
ZnF_C2H2 366 388 1.79e-2 SMART
ZnF_C2H2 392 413 6.57e0 SMART
low complexity region 435 451 N/A INTRINSIC
low complexity region 465 476 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000159916
SMART Domains Protein: ENSMUSP00000124520
Gene: ENSMUSG00000045114

DomainStartEndE-ValueType
low complexity region 69 82 N/A INTRINSIC
low complexity region 91 112 N/A INTRINSIC
low complexity region 146 169 N/A INTRINSIC
Pfam:CD225 263 337 3.8e-27 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000202045
SMART Domains Protein: ENSMUSP00000144042
Gene: ENSMUSG00000045114

DomainStartEndE-ValueType
Pfam:CD225 1 52 3.5e-17 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000202624
SMART Domains Protein: ENSMUSP00000144099
Gene: ENSMUSG00000107068

DomainStartEndE-ValueType
low complexity region 64 77 N/A INTRINSIC
Pfam:PAXIP1_C 85 176 5.9e-29 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000205461
Predicted Effect possibly damaging
Transcript: ENSMUST00000205568
AA Change: V265G

PolyPhen 2 Score 0.630 (Sensitivity: 0.87; Specificity: 0.91)
Predicted Effect probably benign
Transcript: ENSMUST00000205754
Predicted Effect possibly damaging
Transcript: ENSMUST00000206254
AA Change: V242G

PolyPhen 2 Score 0.630 (Sensitivity: 0.87; Specificity: 0.91)
Predicted Effect probably benign
Transcript: ENSMUST00000206291
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 100% (62/62)
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrb3 T A 1: 25,532,630 Q402L probably benign Het
Afap1l1 T C 18: 61,736,846 T638A probably benign Het
Agtr1a A C 13: 30,381,907 K318N possibly damaging Het
Anks1b A G 10: 90,941,432 T1095A probably damaging Het
Ap3d1 A T 10: 80,723,803 I207N probably damaging Het
Arhgef11 T C 3: 87,713,292 L484P possibly damaging Het
Astn2 C T 4: 65,542,669 S1076N probably benign Het
Baat C A 4: 49,490,213 L290F probably benign Het
Boll T C 1: 55,304,598 Y222C probably damaging Het
Bphl A T 13: 34,050,341 I147F possibly damaging Het
C330027C09Rik T A 16: 49,005,821 M417K probably benign Het
Cadps2 T G 6: 23,409,935 D766A unknown Het
Cd300lb T A 11: 114,925,032 K210M probably damaging Het
Cdan1 T C 2: 120,724,704 Q797R probably benign Het
Celsr1 T A 15: 86,033,008 S255C probably damaging Het
Csmd1 G A 8: 16,058,707 S1894L probably damaging Het
Dennd5b T A 6: 149,020,570 K815N probably benign Het
Exd1 A G 2: 119,520,139 V547A probably benign Het
Fbxo15 C T 18: 84,959,118 R52C probably damaging Het
Fip1l1 A G 5: 74,536,799 probably null Het
Flg2 T A 3: 93,203,372 N902K unknown Het
Fyttd1 T A 16: 32,884,248 N76K probably benign Het
Gins1 T A 2: 150,916,166 D57E probably benign Het
Gm5565 G C 5: 146,158,361 probably null Het
Gm6614 T C 6: 141,989,225 K379E probably damaging Het
Gpsm2 T C 3: 108,702,928 Y72C probably damaging Het
Hace1 C A 10: 45,589,507 S53* probably null Het
Insig2 A G 1: 121,306,937 V188A possibly damaging Het
Ism1 T C 2: 139,757,043 V312A probably damaging Het
Jmy A T 13: 93,472,743 Y353N probably damaging Het
Maats1 T A 16: 38,321,601 probably null Het
Mtmr14 T A 6: 113,269,548 I426N probably damaging Het
Olfr1054 A G 2: 86,333,000 S119P possibly damaging Het
Olfr1467 A G 19: 13,364,637 E3G probably benign Het
Olfr394 C T 11: 73,888,275 M32I probably benign Het
Pcdhac2 T A 18: 37,145,360 N464K probably damaging Het
Pcdhb7 T A 18: 37,343,387 H525Q probably benign Het
Pcp4l1 G A 1: 171,174,465 A42V possibly damaging Het
Podn C T 4: 108,017,702 probably null Het
Prim1 A G 10: 128,022,919 D232G probably null Het
Prrt1 T A 17: 34,632,187 M283K possibly damaging Het
Rgs9 A T 11: 109,276,581 I65N probably damaging Het
Scgb2b26 C A 7: 33,944,357 V53L probably benign Het
Shank2 C A 7: 144,411,685 P1010Q probably benign Het
Slc12a4 C T 8: 105,955,715 G121S probably damaging Het
Slc17a6 G T 7: 51,645,018 A158S probably damaging Het
Slc9a9 C T 9: 94,712,898 H154Y probably benign Het
Slco2a1 T A 9: 103,085,749 probably null Het
Snapc3 T C 4: 83,435,270 I182T probably benign Het
Taok2 A G 7: 126,871,088 V856A probably benign Het
Tep1 T A 14: 50,866,038 N265I probably damaging Het
Tespa1 A T 10: 130,362,041 N311Y probably damaging Het
Tpmt G A 13: 47,041,484 Q14* probably null Het
Trim33 T C 3: 103,321,636 F353L possibly damaging Het
Upp1 T C 11: 9,134,743 V154A probably damaging Het
Usp34 T C 11: 23,419,052 I1747T Het
Vmn1r47 T C 6: 90,022,272 S129P probably benign Het
Vmn2r93 A G 17: 18,303,987 Y81C probably benign Het
Ybx2 A T 11: 69,940,355 T259S probably benign Het
Zfp536 T C 7: 37,479,860 T1107A probably benign Het
Zfp583 C T 7: 6,316,586 A476T probably damaging Het
Other mutations in Maz
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01947:Maz APN 7 127024442 critical splice donor site probably null
R0049:Maz UTSW 7 127024586 missense probably damaging 1.00
R0049:Maz UTSW 7 127024586 missense probably damaging 1.00
R1381:Maz UTSW 7 127023152 nonsense probably null
R2114:Maz UTSW 7 127025505 missense probably damaging 1.00
R4628:Maz UTSW 7 127025347 missense possibly damaging 0.92
R4629:Maz UTSW 7 127025347 missense possibly damaging 0.92
R4895:Maz UTSW 7 127025300 unclassified probably null
R5479:Maz UTSW 7 127025688 missense possibly damaging 0.79
R5668:Maz UTSW 7 127025322 missense probably damaging 1.00
R7008:Maz UTSW 7 127024612 missense probably damaging 1.00
R7324:Maz UTSW 7 127024593 missense probably damaging 1.00
R7432:Maz UTSW 7 127023048 missense probably benign 0.33
R7456:Maz UTSW 7 127026317 nonsense probably null
RF003:Maz UTSW 7 127025497 missense probably damaging 1.00
X0035:Maz UTSW 7 127025883 unclassified probably benign
Z1088:Maz UTSW 7 127024474 frame shift probably null
Z1177:Maz UTSW 7 127025896 missense unknown
Predicted Primers PCR Primer
(F):5'- CAGTTGTAGGGCTTGTGCAC -3'
(R):5'- GAGTTCAAGAACGGCTACAAC -3'

Sequencing Primer
(F):5'- ACGTGGTAACTCATGCGGTC -3'
(R):5'- GAACGGCTACAACCTCCGAAG -3'
Posted On2019-09-13