Incidental Mutation 'R7325:Tpmt'
ID568839
Institutional Source Beutler Lab
Gene Symbol Tpmt
Ensembl Gene ENSMUSG00000021376
Gene Namethiopurine methyltransferase
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7325 (G1)
Quality Score225.009
Status Validated
Chromosome13
Chromosomal Location47022482-47044737 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) G to A at 47041484 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Stop codon at position 14 (Q14*)
Ref Sequence ENSEMBL: ENSMUSP00000021806 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021806] [ENSMUST00000037025] [ENSMUST00000110118] [ENSMUST00000124948] [ENSMUST00000136864] [ENSMUST00000143868] [ENSMUST00000154802]
Predicted Effect probably null
Transcript: ENSMUST00000021806
AA Change: Q14*
SMART Domains Protein: ENSMUSP00000021806
Gene: ENSMUSG00000021376
AA Change: Q14*

DomainStartEndE-ValueType
Pfam:TPMT 19 240 4.1e-84 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000037025
SMART Domains Protein: ENSMUSP00000038373
Gene: ENSMUSG00000038080

DomainStartEndE-ValueType
Pfam:zf-CW 138 191 2.6e-13 PFAM
low complexity region 235 253 N/A INTRINSIC
Pfam:SWIRM 286 369 6e-12 PFAM
Pfam:Pyr_redox_2 368 490 3.1e-8 PFAM
Pfam:Thi4 375 446 2.2e-10 PFAM
Pfam:FAD_binding_3 388 423 4.1e-7 PFAM
Pfam:HI0933_like 389 428 1.6e-7 PFAM
Pfam:FAD_binding_2 390 428 1.6e-6 PFAM
Pfam:Pyr_redox 390 438 8e-8 PFAM
Pfam:NAD_binding_8 393 460 1.6e-13 PFAM
Pfam:Amino_oxidase 398 824 3.7e-86 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000110118
AA Change: Q14*
SMART Domains Protein: ENSMUSP00000105745
Gene: ENSMUSG00000021376
AA Change: Q14*

DomainStartEndE-ValueType
Pfam:TPMT 19 205 8.8e-73 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000124948
AA Change: Q38*
SMART Domains Protein: ENSMUSP00000115361
Gene: ENSMUSG00000021376
AA Change: Q38*

DomainStartEndE-ValueType
Pfam:TPMT 43 93 2.4e-18 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000136864
AA Change: Q14*
SMART Domains Protein: ENSMUSP00000120081
Gene: ENSMUSG00000021376
AA Change: Q14*

DomainStartEndE-ValueType
Pfam:TPMT 19 188 3.6e-65 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000143868
SMART Domains Protein: ENSMUSP00000117793
Gene: ENSMUSG00000038080

DomainStartEndE-ValueType
Pfam:zf-CW 137 175 3.6e-13 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000151509
AA Change: Q33*
SMART Domains Protein: ENSMUSP00000120564
Gene: ENSMUSG00000021376
AA Change: Q33*

DomainStartEndE-ValueType
Pfam:TPMT 19 73 3.3e-20 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000154802
AA Change: Q14*
SMART Domains Protein: ENSMUSP00000121827
Gene: ENSMUSG00000021376
AA Change: Q14*

DomainStartEndE-ValueType
Pfam:TPMT 19 182 2.9e-62 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 100% (62/62)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the enzyme that metabolizes thiopurine drugs via S-adenosyl-L-methionine as the S-methyl donor and S-adenosyl-L-homocysteine as a byproduct. Thiopurine drugs such as 6-mercaptopurine are used as chemotherapeutic agents. Genetic polymorphisms that affect this enzymatic activity are correlated with variations in sensitivity and toxicity to such drugs within individuals, causing thiopurine S-methyltransferase deficiency. Related pseudogenes have been identified on chromosomes 3, 18 and X. [provided by RefSeq, Aug 2014]
PHENOTYPE: Homozygous and heterozygous mutation of this gene results in increased sensitivity to mercaptopurine. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrb3 T A 1: 25,532,630 Q402L probably benign Het
Afap1l1 T C 18: 61,736,846 T638A probably benign Het
Agtr1a A C 13: 30,381,907 K318N possibly damaging Het
Anks1b A G 10: 90,941,432 T1095A probably damaging Het
Ap3d1 A T 10: 80,723,803 I207N probably damaging Het
Arhgef11 T C 3: 87,713,292 L484P possibly damaging Het
Astn2 C T 4: 65,542,669 S1076N probably benign Het
Baat C A 4: 49,490,213 L290F probably benign Het
Boll T C 1: 55,304,598 Y222C probably damaging Het
Bphl A T 13: 34,050,341 I147F possibly damaging Het
C330027C09Rik T A 16: 49,005,821 M417K probably benign Het
Cadps2 T G 6: 23,409,935 D766A unknown Het
Cd300lb T A 11: 114,925,032 K210M probably damaging Het
Cdan1 T C 2: 120,724,704 Q797R probably benign Het
Celsr1 T A 15: 86,033,008 S255C probably damaging Het
Csmd1 G A 8: 16,058,707 S1894L probably damaging Het
Dennd5b T A 6: 149,020,570 K815N probably benign Het
Exd1 A G 2: 119,520,139 V547A probably benign Het
Fbxo15 C T 18: 84,959,118 R52C probably damaging Het
Fip1l1 A G 5: 74,536,799 probably null Het
Flg2 T A 3: 93,203,372 N902K unknown Het
Fyttd1 T A 16: 32,884,248 N76K probably benign Het
Gins1 T A 2: 150,916,166 D57E probably benign Het
Gm5565 G C 5: 146,158,361 probably null Het
Gm6614 T C 6: 141,989,225 K379E probably damaging Het
Gpsm2 T C 3: 108,702,928 Y72C probably damaging Het
Hace1 C A 10: 45,589,507 S53* probably null Het
Insig2 A G 1: 121,306,937 V188A possibly damaging Het
Ism1 T C 2: 139,757,043 V312A probably damaging Het
Jmy A T 13: 93,472,743 Y353N probably damaging Het
Maats1 T A 16: 38,321,601 probably null Het
Maz A C 7: 127,025,553 V265G probably benign Het
Mtmr14 T A 6: 113,269,548 I426N probably damaging Het
Olfr1054 A G 2: 86,333,000 S119P possibly damaging Het
Olfr1467 A G 19: 13,364,637 E3G probably benign Het
Olfr394 C T 11: 73,888,275 M32I probably benign Het
Pcdhac2 T A 18: 37,145,360 N464K probably damaging Het
Pcdhb7 T A 18: 37,343,387 H525Q probably benign Het
Pcp4l1 G A 1: 171,174,465 A42V possibly damaging Het
Podn C T 4: 108,017,702 probably null Het
Prim1 A G 10: 128,022,919 D232G probably null Het
Prrt1 T A 17: 34,632,187 M283K possibly damaging Het
Rgs9 A T 11: 109,276,581 I65N probably damaging Het
Scgb2b26 C A 7: 33,944,357 V53L probably benign Het
Shank2 C A 7: 144,411,685 P1010Q probably benign Het
Slc12a4 C T 8: 105,955,715 G121S probably damaging Het
Slc17a6 G T 7: 51,645,018 A158S probably damaging Het
Slc9a9 C T 9: 94,712,898 H154Y probably benign Het
Slco2a1 T A 9: 103,085,749 probably null Het
Snapc3 T C 4: 83,435,270 I182T probably benign Het
Taok2 A G 7: 126,871,088 V856A probably benign Het
Tep1 T A 14: 50,866,038 N265I probably damaging Het
Tespa1 A T 10: 130,362,041 N311Y probably damaging Het
Trim33 T C 3: 103,321,636 F353L possibly damaging Het
Upp1 T C 11: 9,134,743 V154A probably damaging Het
Usp34 T C 11: 23,419,052 I1747T Het
Vmn1r47 T C 6: 90,022,272 S129P probably benign Het
Vmn2r93 A G 17: 18,303,987 Y81C probably benign Het
Ybx2 A T 11: 69,940,355 T259S probably benign Het
Zfp536 T C 7: 37,479,860 T1107A probably benign Het
Zfp583 C T 7: 6,316,586 A476T probably damaging Het
Other mutations in Tpmt
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02865:Tpmt APN 13 47025402 missense probably benign 0.16
R0666:Tpmt UTSW 13 47032454 missense probably damaging 1.00
R0826:Tpmt UTSW 13 47041489 missense probably benign 0.10
R1373:Tpmt UTSW 13 47027258 unclassified probably null
R1640:Tpmt UTSW 13 47027283 nonsense probably null
R5644:Tpmt UTSW 13 47028959 missense probably benign 0.41
R6086:Tpmt UTSW 13 47035030 missense probably damaging 0.99
R6228:Tpmt UTSW 13 47027259 missense probably benign 0.00
R6372:Tpmt UTSW 13 47035894 critical splice donor site probably null
R7035:Tpmt UTSW 13 47040108 missense probably damaging 1.00
R7886:Tpmt UTSW 13 47040162 missense probably damaging 1.00
R7969:Tpmt UTSW 13 47040162 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCCTAACGATATGAGATGACAGTG -3'
(R):5'- AGCTATTGCCCTAGGTAGAGG -3'

Sequencing Primer
(F):5'- ATTACATGCATATGCCACTGCG -3'
(R):5'- AGGGTTTTGTAGCGTTCATTAATAG -3'
Posted On2019-09-13