Incidental Mutation 'R7325:Fyttd1'
ID568843
Institutional Source Beutler Lab
Gene Symbol Fyttd1
Ensembl Gene ENSMUSG00000022800
Gene Nameforty-two-three domain containing 1
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.120) question?
Stock #R7325 (G1)
Quality Score225.009
Status Validated
Chromosome16
Chromosomal Location32877500-32908875 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 32884248 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Lysine at position 76 (N76K)
Ref Sequence ENSEMBL: ENSMUSP00000023489 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023489] [ENSMUST00000120345] [ENSMUST00000171325] [ENSMUST00000232272]
Predicted Effect probably benign
Transcript: ENSMUST00000023489
AA Change: N76K

PolyPhen 2 Score 0.434 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000023489
Gene: ENSMUSG00000022800
AA Change: N76K

DomainStartEndE-ValueType
Pfam:FYTT 10 317 1.7e-176 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000120345
SMART Domains Protein: ENSMUSP00000113541
Gene: ENSMUSG00000022800

DomainStartEndE-ValueType
Pfam:FYTT 2 129 1e-83 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000171325
AA Change: N76K

PolyPhen 2 Score 0.333 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000131446
Gene: ENSMUSG00000022800
AA Change: N76K

DomainStartEndE-ValueType
Pfam:FYTT 3 210 6.8e-137 PFAM
Pfam:FYTT 209 283 4.6e-48 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000232272
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 100% (62/62)
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrb3 T A 1: 25,532,630 Q402L probably benign Het
Afap1l1 T C 18: 61,736,846 T638A probably benign Het
Agtr1a A C 13: 30,381,907 K318N possibly damaging Het
Anks1b A G 10: 90,941,432 T1095A probably damaging Het
Ap3d1 A T 10: 80,723,803 I207N probably damaging Het
Arhgef11 T C 3: 87,713,292 L484P possibly damaging Het
Astn2 C T 4: 65,542,669 S1076N probably benign Het
Baat C A 4: 49,490,213 L290F probably benign Het
Boll T C 1: 55,304,598 Y222C probably damaging Het
Bphl A T 13: 34,050,341 I147F possibly damaging Het
C330027C09Rik T A 16: 49,005,821 M417K probably benign Het
Cadps2 T G 6: 23,409,935 D766A unknown Het
Cd300lb T A 11: 114,925,032 K210M probably damaging Het
Cdan1 T C 2: 120,724,704 Q797R probably benign Het
Celsr1 T A 15: 86,033,008 S255C probably damaging Het
Csmd1 G A 8: 16,058,707 S1894L probably damaging Het
Dennd5b T A 6: 149,020,570 K815N probably benign Het
Exd1 A G 2: 119,520,139 V547A probably benign Het
Fbxo15 C T 18: 84,959,118 R52C probably damaging Het
Fip1l1 A G 5: 74,536,799 probably null Het
Flg2 T A 3: 93,203,372 N902K unknown Het
Gins1 T A 2: 150,916,166 D57E probably benign Het
Gm5565 G C 5: 146,158,361 probably null Het
Gm6614 T C 6: 141,989,225 K379E probably damaging Het
Gpsm2 T C 3: 108,702,928 Y72C probably damaging Het
Hace1 C A 10: 45,589,507 S53* probably null Het
Insig2 A G 1: 121,306,937 V188A possibly damaging Het
Ism1 T C 2: 139,757,043 V312A probably damaging Het
Jmy A T 13: 93,472,743 Y353N probably damaging Het
Maats1 T A 16: 38,321,601 probably null Het
Maz A C 7: 127,025,553 V265G probably benign Het
Mtmr14 T A 6: 113,269,548 I426N probably damaging Het
Olfr1054 A G 2: 86,333,000 S119P possibly damaging Het
Olfr1467 A G 19: 13,364,637 E3G probably benign Het
Olfr394 C T 11: 73,888,275 M32I probably benign Het
Pcdhac2 T A 18: 37,145,360 N464K probably damaging Het
Pcdhb7 T A 18: 37,343,387 H525Q probably benign Het
Pcp4l1 G A 1: 171,174,465 A42V possibly damaging Het
Podn C T 4: 108,017,702 probably null Het
Prim1 A G 10: 128,022,919 D232G probably null Het
Prrt1 T A 17: 34,632,187 M283K possibly damaging Het
Rgs9 A T 11: 109,276,581 I65N probably damaging Het
Scgb2b26 C A 7: 33,944,357 V53L probably benign Het
Shank2 C A 7: 144,411,685 P1010Q probably benign Het
Slc12a4 C T 8: 105,955,715 G121S probably damaging Het
Slc17a6 G T 7: 51,645,018 A158S probably damaging Het
Slc9a9 C T 9: 94,712,898 H154Y probably benign Het
Slco2a1 T A 9: 103,085,749 probably null Het
Snapc3 T C 4: 83,435,270 I182T probably benign Het
Taok2 A G 7: 126,871,088 V856A probably benign Het
Tep1 T A 14: 50,866,038 N265I probably damaging Het
Tespa1 A T 10: 130,362,041 N311Y probably damaging Het
Tpmt G A 13: 47,041,484 Q14* probably null Het
Trim33 T C 3: 103,321,636 F353L possibly damaging Het
Upp1 T C 11: 9,134,743 V154A probably damaging Het
Usp34 T C 11: 23,419,052 I1747T Het
Vmn1r47 T C 6: 90,022,272 S129P probably benign Het
Vmn2r93 A G 17: 18,303,987 Y81C probably benign Het
Ybx2 A T 11: 69,940,355 T259S probably benign Het
Zfp536 T C 7: 37,479,860 T1107A probably benign Het
Zfp583 C T 7: 6,316,586 A476T probably damaging Het
Other mutations in Fyttd1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02072:Fyttd1 APN 16 32900661 missense probably damaging 0.99
IGL03119:Fyttd1 APN 16 32900695 missense probably benign 0.08
R0014:Fyttd1 UTSW 16 32905554 missense probably damaging 1.00
R0014:Fyttd1 UTSW 16 32905554 missense probably damaging 1.00
R1742:Fyttd1 UTSW 16 32905553 nonsense probably null
R5018:Fyttd1 UTSW 16 32902417 critical splice acceptor site probably null
R5800:Fyttd1 UTSW 16 32891288 missense probably damaging 1.00
R5893:Fyttd1 UTSW 16 32898913 missense probably damaging 1.00
Z1177:Fyttd1 UTSW 16 32877784 unclassified probably benign
Predicted Primers PCR Primer
(F):5'- GGGGCCTAGGAGAAATCTATTGAC -3'
(R):5'- AGGCTACATAAGACCTTTGGC -3'

Sequencing Primer
(F):5'- GGAGAAATCTATTGACTATACATTGA -3'
(R):5'- GGCTACATAAGACCTTTGGCAAATC -3'
Posted On2019-09-13