Incidental Mutation 'R7325:C330027C09Rik'
ID568844
Institutional Source Beutler Lab
Gene Symbol C330027C09Rik
Ensembl Gene ENSMUSG00000033031
Gene NameRIKEN cDNA C330027C09 gene
SynonymsCip2a
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.962) question?
Stock #R7325 (G1)
Quality Score225.009
Status Validated
Chromosome16
Chromosomal Location48994185-49019709 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 49005821 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Lysine at position 417 (M417K)
Ref Sequence ENSEMBL: ENSMUSP00000044714 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000048374] [ENSMUST00000117994]
Predicted Effect probably benign
Transcript: ENSMUST00000048374
AA Change: M417K

PolyPhen 2 Score 0.324 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000044714
Gene: ENSMUSG00000033031
AA Change: M417K

DomainStartEndE-ValueType
SCOP:d1jdha_ 47 309 3e-4 SMART
low complexity region 439 450 N/A INTRINSIC
coiled coil region 635 887 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000117994
AA Change: M417K

PolyPhen 2 Score 0.219 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000113075
Gene: ENSMUSG00000033031
AA Change: M417K

DomainStartEndE-ValueType
SCOP:d1jdha_ 47 309 2e-4 SMART
low complexity region 439 450 N/A INTRINSIC
coiled coil region 635 887 N/A INTRINSIC
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 100% (62/62)
MGI Phenotype PHENOTYPE: Mice homozygous for a hypomorphic allele display oligozoospermia, small epididymis and impaired spermatogonial progenitor cell maintenance. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrb3 T A 1: 25,532,630 Q402L probably benign Het
Afap1l1 T C 18: 61,736,846 T638A probably benign Het
Agtr1a A C 13: 30,381,907 K318N possibly damaging Het
Anks1b A G 10: 90,941,432 T1095A probably damaging Het
Ap3d1 A T 10: 80,723,803 I207N probably damaging Het
Arhgef11 T C 3: 87,713,292 L484P possibly damaging Het
Astn2 C T 4: 65,542,669 S1076N probably benign Het
Baat C A 4: 49,490,213 L290F probably benign Het
Boll T C 1: 55,304,598 Y222C probably damaging Het
Bphl A T 13: 34,050,341 I147F possibly damaging Het
Cadps2 T G 6: 23,409,935 D766A unknown Het
Cd300lb T A 11: 114,925,032 K210M probably damaging Het
Cdan1 T C 2: 120,724,704 Q797R probably benign Het
Celsr1 T A 15: 86,033,008 S255C probably damaging Het
Csmd1 G A 8: 16,058,707 S1894L probably damaging Het
Dennd5b T A 6: 149,020,570 K815N probably benign Het
Exd1 A G 2: 119,520,139 V547A probably benign Het
Fbxo15 C T 18: 84,959,118 R52C probably damaging Het
Fip1l1 A G 5: 74,536,799 probably null Het
Flg2 T A 3: 93,203,372 N902K unknown Het
Fyttd1 T A 16: 32,884,248 N76K probably benign Het
Gins1 T A 2: 150,916,166 D57E probably benign Het
Gm5565 G C 5: 146,158,361 probably null Het
Gm6614 T C 6: 141,989,225 K379E probably damaging Het
Gpsm2 T C 3: 108,702,928 Y72C probably damaging Het
Hace1 C A 10: 45,589,507 S53* probably null Het
Insig2 A G 1: 121,306,937 V188A possibly damaging Het
Ism1 T C 2: 139,757,043 V312A probably damaging Het
Jmy A T 13: 93,472,743 Y353N probably damaging Het
Maats1 T A 16: 38,321,601 probably null Het
Maz A C 7: 127,025,553 V265G probably benign Het
Mtmr14 T A 6: 113,269,548 I426N probably damaging Het
Olfr1054 A G 2: 86,333,000 S119P possibly damaging Het
Olfr1467 A G 19: 13,364,637 E3G probably benign Het
Olfr394 C T 11: 73,888,275 M32I probably benign Het
Pcdhac2 T A 18: 37,145,360 N464K probably damaging Het
Pcdhb7 T A 18: 37,343,387 H525Q probably benign Het
Pcp4l1 G A 1: 171,174,465 A42V possibly damaging Het
Podn C T 4: 108,017,702 probably null Het
Prim1 A G 10: 128,022,919 D232G probably null Het
Prrt1 T A 17: 34,632,187 M283K possibly damaging Het
Rgs9 A T 11: 109,276,581 I65N probably damaging Het
Scgb2b26 C A 7: 33,944,357 V53L probably benign Het
Shank2 C A 7: 144,411,685 P1010Q probably benign Het
Slc12a4 C T 8: 105,955,715 G121S probably damaging Het
Slc17a6 G T 7: 51,645,018 A158S probably damaging Het
Slc9a9 C T 9: 94,712,898 H154Y probably benign Het
Slco2a1 T A 9: 103,085,749 probably null Het
Snapc3 T C 4: 83,435,270 I182T probably benign Het
Taok2 A G 7: 126,871,088 V856A probably benign Het
Tep1 T A 14: 50,866,038 N265I probably damaging Het
Tespa1 A T 10: 130,362,041 N311Y probably damaging Het
Tpmt G A 13: 47,041,484 Q14* probably null Het
Trim33 T C 3: 103,321,636 F353L possibly damaging Het
Upp1 T C 11: 9,134,743 V154A probably damaging Het
Usp34 T C 11: 23,419,052 I1747T Het
Vmn1r47 T C 6: 90,022,272 S129P probably benign Het
Vmn2r93 A G 17: 18,303,987 Y81C probably benign Het
Ybx2 A T 11: 69,940,355 T259S probably benign Het
Zfp536 T C 7: 37,479,860 T1107A probably benign Het
Zfp583 C T 7: 6,316,586 A476T probably damaging Het
Other mutations in C330027C09Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00402:C330027C09Rik APN 16 49001815 missense probably damaging 1.00
IGL00788:C330027C09Rik APN 16 49009069 splice site probably benign
IGL01343:C330027C09Rik APN 16 49013188 missense probably damaging 1.00
IGL01348:C330027C09Rik APN 16 49013188 missense probably damaging 1.00
IGL01876:C330027C09Rik APN 16 49001678 missense probably damaging 1.00
IGL02255:C330027C09Rik APN 16 49010813 missense probably damaging 0.99
IGL02515:C330027C09Rik APN 16 49005733 missense possibly damaging 0.47
IGL03295:C330027C09Rik APN 16 48994341 missense probably damaging 1.00
R0020:C330027C09Rik UTSW 16 49001612 missense probably damaging 1.00
R0020:C330027C09Rik UTSW 16 49001612 missense probably damaging 1.00
R0031:C330027C09Rik UTSW 16 49017373 missense probably benign 0.14
R0612:C330027C09Rik UTSW 16 48999039 missense probably benign 0.04
R1187:C330027C09Rik UTSW 16 49000293 missense probably damaging 1.00
R1707:C330027C09Rik UTSW 16 49018404 missense probably damaging 1.00
R1711:C330027C09Rik UTSW 16 49017486 missense probably benign 0.31
R1715:C330027C09Rik UTSW 16 49005719 missense probably benign 0.18
R2000:C330027C09Rik UTSW 16 49014969 missense probably damaging 0.99
R2002:C330027C09Rik UTSW 16 49005851 splice site probably benign
R2360:C330027C09Rik UTSW 16 49017465 nonsense probably null
R4093:C330027C09Rik UTSW 16 49000976 splice site probably benign
R4292:C330027C09Rik UTSW 16 49013249 missense probably benign 0.00
R4293:C330027C09Rik UTSW 16 49013249 missense probably benign 0.00
R4295:C330027C09Rik UTSW 16 49013249 missense probably benign 0.00
R4726:C330027C09Rik UTSW 16 49014070 missense probably benign 0.02
R4925:C330027C09Rik UTSW 16 49016363 critical splice donor site probably null
R5735:C330027C09Rik UTSW 16 49017493 critical splice donor site probably null
R5893:C330027C09Rik UTSW 16 48997500 missense probably benign
R6146:C330027C09Rik UTSW 16 48994329 nonsense probably null
R6649:C330027C09Rik UTSW 16 49017466 missense probably damaging 1.00
R7235:C330027C09Rik UTSW 16 49001059 missense probably damaging 1.00
R7300:C330027C09Rik UTSW 16 49013854 missense probably damaging 1.00
R7365:C330027C09Rik UTSW 16 49001653 missense probably benign 0.35
R7414:C330027C09Rik UTSW 16 49001635 missense probably benign 0.21
R7715:C330027C09Rik UTSW 16 49013984 missense probably damaging 0.99
R7780:C330027C09Rik UTSW 16 49001660 nonsense probably null
Predicted Primers PCR Primer
(F):5'- CAAGACAATTCTGAAAGCTGGC -3'
(R):5'- GAACCACAGTCCATATACTTTGAGC -3'

Sequencing Primer
(F):5'- TCTGAAAGCTGGCTAAAATGC -3'
(R):5'- GCTGGGAACTGAACTCAAGCC -3'
Posted On2019-09-13