Incidental Mutation 'R7325:Fbxo15'
ID568850
Institutional Source Beutler Lab
Gene Symbol Fbxo15
Ensembl Gene ENSMUSG00000034391
Gene NameF-box protein 15
SynonymsFbx15, ecat3
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7325 (G1)
Quality Score225.009
Status Validated
Chromosome18
Chromosomal Location84934782-84981472 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 84959118 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Cysteine at position 52 (R52C)
Ref Sequence ENSEMBL: ENSMUSP00000152915 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000037718] [ENSMUST00000224467] [ENSMUST00000225445]
Predicted Effect possibly damaging
Transcript: ENSMUST00000037718
AA Change: R97C

PolyPhen 2 Score 0.842 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000045925
Gene: ENSMUSG00000034391
AA Change: R97C

DomainStartEndE-ValueType
low complexity region 35 42 N/A INTRINSIC
FBOX 46 86 3.4e-7 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000223789
Predicted Effect noncoding transcript
Transcript: ENSMUST00000224427
Predicted Effect possibly damaging
Transcript: ENSMUST00000224467
AA Change: R52C

PolyPhen 2 Score 0.842 (Sensitivity: 0.83; Specificity: 0.93)
Predicted Effect probably damaging
Transcript: ENSMUST00000225445
AA Change: R52C

PolyPhen 2 Score 0.962 (Sensitivity: 0.78; Specificity: 0.95)
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 100% (62/62)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Members of the F-box protein family, such as FBXO15, are characterized by an approximately 40-amino acid F-box motif. SCF complexes, formed by SKP1 (MIM 601434), cullin (see CUL1; MIM 603134), and F-box proteins, act as protein-ubiquitin ligases. F-box proteins interact with SKP1 through the F box, and they interact with ubiquitination targets through other protein interaction domains (Jin et al., 2004 [PubMed 15520277]).[supplied by OMIM, Mar 2008]
PHENOTYPE: Both male and female homozygous null mice develop normally and are fertile. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrb3 T A 1: 25,532,630 Q402L probably benign Het
Afap1l1 T C 18: 61,736,846 T638A probably benign Het
Agtr1a A C 13: 30,381,907 K318N possibly damaging Het
Anks1b A G 10: 90,941,432 T1095A probably damaging Het
Ap3d1 A T 10: 80,723,803 I207N probably damaging Het
Arhgef11 T C 3: 87,713,292 L484P possibly damaging Het
Astn2 C T 4: 65,542,669 S1076N probably benign Het
Baat C A 4: 49,490,213 L290F probably benign Het
Boll T C 1: 55,304,598 Y222C probably damaging Het
Bphl A T 13: 34,050,341 I147F possibly damaging Het
C330027C09Rik T A 16: 49,005,821 M417K probably benign Het
Cadps2 T G 6: 23,409,935 D766A unknown Het
Cd300lb T A 11: 114,925,032 K210M probably damaging Het
Cdan1 T C 2: 120,724,704 Q797R probably benign Het
Celsr1 T A 15: 86,033,008 S255C probably damaging Het
Csmd1 G A 8: 16,058,707 S1894L probably damaging Het
Dennd5b T A 6: 149,020,570 K815N probably benign Het
Exd1 A G 2: 119,520,139 V547A probably benign Het
Fip1l1 A G 5: 74,536,799 probably null Het
Flg2 T A 3: 93,203,372 N902K unknown Het
Fyttd1 T A 16: 32,884,248 N76K probably benign Het
Gins1 T A 2: 150,916,166 D57E probably benign Het
Gm5565 G C 5: 146,158,361 probably null Het
Gm6614 T C 6: 141,989,225 K379E probably damaging Het
Gpsm2 T C 3: 108,702,928 Y72C probably damaging Het
Hace1 C A 10: 45,589,507 S53* probably null Het
Insig2 A G 1: 121,306,937 V188A possibly damaging Het
Ism1 T C 2: 139,757,043 V312A probably damaging Het
Jmy A T 13: 93,472,743 Y353N probably damaging Het
Maats1 T A 16: 38,321,601 probably null Het
Maz A C 7: 127,025,553 V265G probably benign Het
Mtmr14 T A 6: 113,269,548 I426N probably damaging Het
Olfr1054 A G 2: 86,333,000 S119P possibly damaging Het
Olfr1467 A G 19: 13,364,637 E3G probably benign Het
Olfr394 C T 11: 73,888,275 M32I probably benign Het
Pcdhac2 T A 18: 37,145,360 N464K probably damaging Het
Pcdhb7 T A 18: 37,343,387 H525Q probably benign Het
Pcp4l1 G A 1: 171,174,465 A42V possibly damaging Het
Podn C T 4: 108,017,702 probably null Het
Prim1 A G 10: 128,022,919 D232G probably null Het
Prrt1 T A 17: 34,632,187 M283K possibly damaging Het
Rgs9 A T 11: 109,276,581 I65N probably damaging Het
Scgb2b26 C A 7: 33,944,357 V53L probably benign Het
Shank2 C A 7: 144,411,685 P1010Q probably benign Het
Slc12a4 C T 8: 105,955,715 G121S probably damaging Het
Slc17a6 G T 7: 51,645,018 A158S probably damaging Het
Slc9a9 C T 9: 94,712,898 H154Y probably benign Het
Slco2a1 T A 9: 103,085,749 probably null Het
Snapc3 T C 4: 83,435,270 I182T probably benign Het
Taok2 A G 7: 126,871,088 V856A probably benign Het
Tep1 T A 14: 50,866,038 N265I probably damaging Het
Tespa1 A T 10: 130,362,041 N311Y probably damaging Het
Tpmt G A 13: 47,041,484 Q14* probably null Het
Trim33 T C 3: 103,321,636 F353L possibly damaging Het
Upp1 T C 11: 9,134,743 V154A probably damaging Het
Usp34 T C 11: 23,419,052 I1747T Het
Vmn1r47 T C 6: 90,022,272 S129P probably benign Het
Vmn2r93 A G 17: 18,303,987 Y81C probably benign Het
Ybx2 A T 11: 69,940,355 T259S probably benign Het
Zfp536 T C 7: 37,479,860 T1107A probably benign Het
Zfp583 C T 7: 6,316,586 A476T probably damaging Het
Other mutations in Fbxo15
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00517:Fbxo15 APN 18 84959100 missense probably damaging 1.00
IGL01375:Fbxo15 APN 18 84958279 missense possibly damaging 0.64
IGL01730:Fbxo15 APN 18 84964174 missense probably benign 0.38
IGL01807:Fbxo15 APN 18 84981381 utr 3 prime probably benign
IGL02220:Fbxo15 APN 18 84964192 critical splice donor site probably null
IGL02255:Fbxo15 APN 18 84964196 splice site probably null
IGL02435:Fbxo15 APN 18 84959226 missense probably damaging 0.97
IGL02546:Fbxo15 APN 18 84962722 critical splice donor site probably null
IGL03099:Fbxo15 APN 18 84981213 missense possibly damaging 0.87
R0346:Fbxo15 UTSW 18 84960221 critical splice donor site probably null
R1606:Fbxo15 UTSW 18 84962620 missense possibly damaging 0.93
R1671:Fbxo15 UTSW 18 84959106 missense possibly damaging 0.73
R2113:Fbxo15 UTSW 18 84959105 missense probably benign 0.00
R3962:Fbxo15 UTSW 18 84959247 missense probably benign 0.02
R4064:Fbxo15 UTSW 18 84959118 missense probably damaging 0.96
R5523:Fbxo15 UTSW 18 84960069 missense probably damaging 1.00
R5931:Fbxo15 UTSW 18 84981125 missense probably damaging 0.96
R6235:Fbxo15 UTSW 18 84980904 intron probably benign
R6349:Fbxo15 UTSW 18 84964142 missense probably benign 0.01
R6607:Fbxo15 UTSW 18 84959145 missense possibly damaging 0.88
R7232:Fbxo15 UTSW 18 84962622 missense probably damaging 1.00
R7519:Fbxo15 UTSW 18 84964234 unclassified probably benign
R7671:Fbxo15 UTSW 18 84964153 missense probably damaging 1.00
X0022:Fbxo15 UTSW 18 84960119 missense probably benign 0.00
Z1177:Fbxo15 UTSW 18 84958308 nonsense probably null
Predicted Primers PCR Primer
(F):5'- TCCCTGTTTGCTTTAAATGAGGAAC -3'
(R):5'- TTCGAAGGAAGGCTTGTGCG -3'

Sequencing Primer
(F):5'- TGCTTTAAATGAGGAACCCACAG -3'
(R):5'- CGGCGTTTGACAGGACTGAG -3'
Posted On2019-09-13