Incidental Mutation 'R7326:Celsr2'
ID 568873
Institutional Source Beutler Lab
Gene Symbol Celsr2
Ensembl Gene ENSMUSG00000068740
Gene Name cadherin, EGF LAG seven-pass G-type receptor 2
Synonyms EGFL2, Adgrc2, flamingo, mfmi1
MMRRC Submission 045378-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R7326 (G1)
Quality Score 225.009
Status Not validated
Chromosome 3
Chromosomal Location 108298167-108323383 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to C at 108302311 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Phenylalanine to Valine at position 2606 (F2606V)
Ref Sequence ENSEMBL: ENSMUSP00000088046 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000090558]
AlphaFold no structure available at present
Predicted Effect possibly damaging
Transcript: ENSMUST00000090558
AA Change: F2606V

PolyPhen 2 Score 0.852 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000088046
Gene: ENSMUSG00000068740
AA Change: F2606V

DomainStartEndE-ValueType
signal peptide 1 31 N/A INTRINSIC
low complexity region 35 53 N/A INTRINSIC
CA 203 287 1.36e-26 SMART
CA 311 397 1.33e-29 SMART
CA 421 503 2.59e-27 SMART
CA 527 608 3.33e-30 SMART
CA 632 710 5.18e-18 SMART
CA 734 813 1.08e-29 SMART
CA 837 919 8.08e-29 SMART
low complexity region 920 932 N/A INTRINSIC
CA 943 1021 4.3e-24 SMART
CA 1049 1125 1.87e-1 SMART
low complexity region 1188 1198 N/A INTRINSIC
EGF 1231 1286 1.81e-3 SMART
EGF_CA 1288 1324 2.24e-8 SMART
EGF 1331 1366 6.65e-2 SMART
LamG 1387 1554 8.4e-30 SMART
EGF 1577 1610 8e-5 SMART
LamG 1636 1770 1.56e-24 SMART
EGF 1796 1829 2.35e-2 SMART
EGF 1831 1867 3.88e-3 SMART
TNFR 1908 1943 1.35e-1 SMART
EGF_Lam 1924 1969 9.54e-12 SMART
HormR 1972 2034 1.57e-20 SMART
Pfam:GAIN 2046 2289 3e-62 PFAM
GPS 2315 2368 1.86e-25 SMART
Pfam:7tm_2 2373 2605 1.1e-48 PFAM
low complexity region 2715 2733 N/A INTRINSIC
low complexity region 2857 2873 N/A INTRINSIC
low complexity region 2874 2881 N/A INTRINSIC
Predicted Effect
SMART Domains Protein: ENSMUSP00000122329
Gene: ENSMUSG00000068740
AA Change: F594V

DomainStartEndE-ValueType
Pfam:GAIN 35 278 5.1e-63 PFAM
GPS 304 357 1.86e-25 SMART
Pfam:7tm_2 362 594 2e-49 PFAM
low complexity region 704 722 N/A INTRINSIC
low complexity region 846 862 N/A INTRINSIC
low complexity region 863 870 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the flamingo subfamily, part of the cadherin superfamily. The flamingo subfamily consists of nonclassic-type cadherins; a subpopulation that does not interact with catenins. The flamingo cadherins are located at the plasma membrane and have nine cadherin domains, seven epidermal growth factor-like repeats and two laminin A G-type repeats in their ectodomain. They also have seven transmembrane domains, a characteristic unique to this subfamily. It is postulated that these proteins are receptors involved in contact-mediated communication, with cadherin domains acting as homophilic binding regions and the EGF-like domains involved in cell adhesion and receptor-ligand interactions. The specific function of this particular member has not been determined. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for disruptions in this allele have mild to moderately dilated lateral ventricles in the brain but are otherwise normal. [provided by MGI curators]
Allele List at MGI

All alleles(4) : Targeted, knock-out(1) Targeted, other(3)

Other mutations in this stock
Total: 112 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb4 T C 5: 8,984,226 (GRCm39) V652A probably benign Het
Acvrl1 G T 15: 101,038,953 (GRCm39) V417L probably damaging Het
Add1 A G 5: 34,776,715 (GRCm39) R479G probably benign Het
Adgb A T 10: 10,276,318 (GRCm39) L350Q possibly damaging Het
Adgrl2 A T 3: 148,552,506 (GRCm39) S666T probably benign Het
Akap9 T A 5: 4,095,930 (GRCm39) D2268E possibly damaging Het
Amigo3 C A 9: 107,931,265 (GRCm39) H229Q probably benign Het
Ano6 G C 15: 95,762,125 (GRCm39) Q31H possibly damaging Het
Ap4m1 G A 5: 138,173,281 (GRCm39) D180N probably damaging Het
Apc2 A T 10: 80,147,574 (GRCm39) D876V probably damaging Het
Apcdd1 T A 18: 63,085,259 (GRCm39) Y485* probably null Het
Aqp1 G T 6: 55,313,836 (GRCm39) D121Y probably benign Het
Bicd2 C A 13: 49,523,085 (GRCm39) R141S probably benign Het
Brpf3 C A 17: 29,025,267 (GRCm39) H113Q probably benign Het
Cacng2 A T 15: 77,897,520 (GRCm39) Y96* probably null Het
Catsperg1 G T 7: 28,910,184 (GRCm39) N52K possibly damaging Het
Cerkl A T 2: 79,162,949 (GRCm39) N516K probably benign Het
Ciita G A 16: 10,330,152 (GRCm39) R812H probably damaging Het
Cldn3 T A 5: 135,015,837 (GRCm39) L180Q probably damaging Het
Cnot6l T C 5: 96,225,158 (GRCm39) I512V probably benign Het
Col5a2 A T 1: 45,482,027 (GRCm39) D32E unknown Het
Coro7 A G 16: 4,449,912 (GRCm39) V616A probably damaging Het
Cyp4f18 T C 8: 72,742,498 (GRCm39) D494G probably benign Het
Ddx39a T A 8: 84,449,100 (GRCm39) V296E probably benign Het
Dgkg A T 16: 22,367,440 (GRCm39) H593Q probably damaging Het
Dhx16 T C 17: 36,197,052 (GRCm39) L645P probably damaging Het
Dnah14 A G 1: 181,425,968 (GRCm39) M171V probably benign Het
Dnhd1 G A 7: 105,370,137 (GRCm39) V4521I probably damaging Het
Dok7 A T 5: 35,221,866 (GRCm39) M60L probably benign Het
Donson A T 16: 91,485,599 (GRCm39) M1K probably null Het
Dsp C T 13: 38,376,859 (GRCm39) T1548M probably benign Het
Dyrk1a A G 16: 94,492,902 (GRCm39) T712A probably damaging Het
Eef2 A G 10: 81,017,116 (GRCm39) T708A probably benign Het
Epn3 G A 11: 94,384,606 (GRCm39) T289I probably benign Het
Fam171a1 C T 2: 3,227,509 (GRCm39) R881* probably null Het
Fat2 T A 11: 55,173,130 (GRCm39) R2528W probably damaging Het
Fbxl9 T C 8: 106,039,530 (GRCm39) D127G probably damaging Het
Fgfr1 T G 8: 26,063,855 (GRCm39) F707C probably damaging Het
Frem2 G C 3: 53,562,174 (GRCm39) P778A probably damaging Het
Ganc A G 2: 120,261,080 (GRCm39) Y255C probably damaging Het
Garin4 G A 1: 190,896,550 (GRCm39) T31M probably benign Het
Ginm1 A T 10: 7,653,614 (GRCm39) Y65* probably null Het
Gm11559 T A 11: 99,755,707 (GRCm39) C119S unknown Het
Gnai1 T A 5: 18,494,549 (GRCm39) H188L Het
H2bc6 T C 13: 23,769,906 (GRCm39) K12E probably benign Het
H6pd C T 4: 150,080,807 (GRCm39) A13T probably benign Het
Hoxd12 A T 2: 74,505,590 (GRCm39) T54S possibly damaging Het
Hs3st5 T A 10: 36,709,190 (GRCm39) L242M probably damaging Het
Il9r C A 11: 32,144,389 (GRCm39) V139L possibly damaging Het
Immt A G 6: 71,823,353 (GRCm39) D68G probably damaging Het
Itsn2 A G 12: 4,682,985 (GRCm39) I304V unknown Het
Lgr4 G A 2: 109,826,974 (GRCm39) W159* probably null Het
Lin52 G A 12: 84,504,728 (GRCm39) G38S probably damaging Het
Lpgat1 A T 1: 191,451,565 (GRCm39) M64L probably benign Het
Lrrc10b G T 19: 10,434,142 (GRCm39) R180S possibly damaging Het
Lrrc36 A T 8: 106,176,401 (GRCm39) L258F possibly damaging Het
Ltbp4 T A 7: 27,029,180 (GRCm39) Q235L unknown Het
Maml2 A G 9: 13,532,903 (GRCm39) M706V Het
Mc5r G T 18: 68,472,739 (GRCm39) C366F probably damaging Het
Mlip T C 9: 77,072,124 (GRCm39) R244G probably benign Het
Muc16 T A 9: 18,496,309 (GRCm39) R6658S probably benign Het
Mup4 G T 4: 59,960,046 (GRCm39) H73N possibly damaging Het
Nf1 A G 11: 79,455,769 (GRCm39) M565V probably benign Het
Nphp1 G A 2: 127,603,137 (GRCm39) T382I possibly damaging Het
Nrcam C T 12: 44,610,809 (GRCm39) T503I possibly damaging Het
Nwd2 A T 5: 63,957,752 (GRCm39) N361Y probably damaging Het
Or10a3 A T 7: 108,480,023 (GRCm39) H263Q probably damaging Het
Or4f15 A T 2: 111,813,672 (GRCm39) L249* probably null Het
Or5ak23 A T 2: 85,244,788 (GRCm39) V145E probably damaging Het
Or6f1 A G 7: 85,970,782 (GRCm39) I126T probably damaging Het
Or7g21 A G 9: 19,032,965 (GRCm39) Y235C probably benign Het
Or8j3 A G 2: 86,028,917 (GRCm39) Y60H probably damaging Het
Or9a7 G T 6: 40,521,829 (GRCm39) A28E probably damaging Het
Orc5 A G 5: 22,728,582 (GRCm39) F308L probably benign Het
Padi1 T A 4: 140,559,715 (GRCm39) Y54F probably benign Het
Parp1 A G 1: 180,396,665 (GRCm39) K23E possibly damaging Het
Pate1 A T 9: 35,597,268 (GRCm39) V79D possibly damaging Het
Pcdh18 T C 3: 49,711,309 (GRCm39) H2R probably benign Het
Pcnx2 G A 8: 126,613,822 (GRCm39) S543F probably damaging Het
Pcp4l1 G A 1: 171,002,034 (GRCm39) A42V possibly damaging Het
Pnkp T A 7: 44,509,158 (GRCm39) F169L probably damaging Het
Ppp6r3 A T 19: 3,557,325 (GRCm39) N254K probably damaging Het
Psd A G 19: 46,312,893 (GRCm39) L159P probably benign Het
Ptprf A G 4: 118,088,866 (GRCm39) Y646H probably damaging Het
Rab3ip A T 10: 116,773,538 (GRCm39) S92T probably benign Het
Rabgef1 A G 5: 130,216,192 (GRCm39) probably benign Het
Ralgapa1 C A 12: 55,755,789 (GRCm39) W1129L probably damaging Het
Rhpn2 T A 7: 35,084,888 (GRCm39) L594Q probably benign Het
Rnf38 C A 4: 44,158,989 (GRCm39) probably benign Het
Ryr2 T A 13: 11,753,080 (GRCm39) H1747L possibly damaging Het
Sec16a A G 2: 26,329,729 (GRCm39) L13P unknown Het
Spef1l A T 7: 139,558,458 (GRCm39) probably null Het
Sppl3 C A 5: 115,220,394 (GRCm39) T102K probably damaging Het
Srgap2 A T 1: 131,219,351 (GRCm39) Y264* probably null Het
Stxbp2 T C 8: 3,691,151 (GRCm39) M465T Het
Sumf2 A G 5: 129,891,551 (GRCm39) K305R probably benign Het
Susd2 T A 10: 75,478,399 (GRCm39) Y59F probably benign Het
Taco1 T C 11: 105,963,443 (GRCm39) V198A probably benign Het
Tas2r136 A T 6: 132,754,869 (GRCm39) M86K possibly damaging Het
Tbc1d10c T C 19: 4,234,897 (GRCm39) E388G possibly damaging Het
Tmem132c C T 5: 127,641,123 (GRCm39) T1098I possibly damaging Het
Trim3 G T 7: 105,267,007 (GRCm39) Y457* probably null Het
Ttc38 A G 15: 85,737,062 (GRCm39) T316A probably benign Het
Ubqln4 T A 3: 88,463,217 (GRCm39) N127K probably benign Het
Wdr91 A T 6: 34,881,561 (GRCm39) F262Y probably damaging Het
Zdhhc6 A T 19: 55,291,187 (GRCm39) C343S possibly damaging Het
Zfp248 A G 6: 118,407,170 (GRCm39) C140R probably damaging Het
Zfp266 T C 9: 20,413,391 (GRCm39) T90A probably benign Het
Zfp407 A T 18: 84,577,167 (GRCm39) D1315E possibly damaging Het
Zfp644 T C 5: 106,786,143 (GRCm39) S135G probably benign Het
Zscan29 A T 2: 120,991,469 (GRCm39) I773N probably damaging Het
Zswim5 T A 4: 116,838,031 (GRCm39) V787E possibly damaging Het
Other mutations in Celsr2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00898:Celsr2 APN 3 108,321,195 (GRCm39) missense possibly damaging 0.49
IGL01020:Celsr2 APN 3 108,310,586 (GRCm39) missense probably damaging 0.99
IGL01420:Celsr2 APN 3 108,301,079 (GRCm39) missense probably benign 0.13
IGL01448:Celsr2 APN 3 108,300,555 (GRCm39) missense probably damaging 0.99
IGL01559:Celsr2 APN 3 108,314,183 (GRCm39) missense possibly damaging 0.75
IGL01674:Celsr2 APN 3 108,322,159 (GRCm39) missense probably damaging 1.00
IGL01863:Celsr2 APN 3 108,301,338 (GRCm39) missense probably benign 0.00
IGL02309:Celsr2 APN 3 108,303,327 (GRCm39) missense probably damaging 1.00
IGL02325:Celsr2 APN 3 108,320,187 (GRCm39) missense probably damaging 1.00
IGL02409:Celsr2 APN 3 108,321,271 (GRCm39) missense probably damaging 1.00
IGL02514:Celsr2 APN 3 108,304,826 (GRCm39) missense probably benign 0.01
IGL02812:Celsr2 APN 3 108,321,429 (GRCm39) missense probably benign 0.25
IGL02894:Celsr2 APN 3 108,302,526 (GRCm39) missense probably damaging 1.00
IGL03281:Celsr2 APN 3 108,320,256 (GRCm39) missense probably damaging 1.00
barrow UTSW 3 108,302,281 (GRCm39) missense possibly damaging 0.92
goldeneye UTSW 3 108,302,235 (GRCm39) missense probably damaging 1.00
1mM(1):Celsr2 UTSW 3 108,308,154 (GRCm39) missense probably benign 0.01
ANU74:Celsr2 UTSW 3 108,319,815 (GRCm39) missense probably damaging 1.00
IGL02799:Celsr2 UTSW 3 108,321,378 (GRCm39) missense probably damaging 1.00
R0011:Celsr2 UTSW 3 108,320,718 (GRCm39) missense probably benign 0.19
R0031:Celsr2 UTSW 3 108,320,379 (GRCm39) missense probably damaging 1.00
R0049:Celsr2 UTSW 3 108,304,570 (GRCm39) missense probably benign 0.12
R0049:Celsr2 UTSW 3 108,304,570 (GRCm39) missense probably benign 0.12
R0090:Celsr2 UTSW 3 108,300,643 (GRCm39) splice site probably benign
R0140:Celsr2 UTSW 3 108,305,249 (GRCm39) missense probably benign 0.00
R0524:Celsr2 UTSW 3 108,308,903 (GRCm39) missense probably damaging 1.00
R0607:Celsr2 UTSW 3 108,311,211 (GRCm39) critical splice donor site probably null
R0662:Celsr2 UTSW 3 108,305,836 (GRCm39) missense probably damaging 0.99
R0690:Celsr2 UTSW 3 108,322,293 (GRCm39) missense probably damaging 1.00
R0691:Celsr2 UTSW 3 108,319,939 (GRCm39) missense probably damaging 1.00
R0710:Celsr2 UTSW 3 108,320,028 (GRCm39) missense probably benign 0.42
R0730:Celsr2 UTSW 3 108,305,922 (GRCm39) missense probably damaging 1.00
R0815:Celsr2 UTSW 3 108,308,617 (GRCm39) missense possibly damaging 0.56
R0848:Celsr2 UTSW 3 108,321,654 (GRCm39) missense probably benign
R0989:Celsr2 UTSW 3 108,310,588 (GRCm39) missense probably benign 0.00
R1185:Celsr2 UTSW 3 108,307,025 (GRCm39) missense possibly damaging 0.95
R1185:Celsr2 UTSW 3 108,307,025 (GRCm39) missense possibly damaging 0.95
R1185:Celsr2 UTSW 3 108,307,025 (GRCm39) missense possibly damaging 0.95
R1469:Celsr2 UTSW 3 108,321,424 (GRCm39) missense probably damaging 1.00
R1469:Celsr2 UTSW 3 108,321,424 (GRCm39) missense probably damaging 1.00
R1474:Celsr2 UTSW 3 108,301,055 (GRCm39) missense possibly damaging 0.91
R1608:Celsr2 UTSW 3 108,309,799 (GRCm39) missense probably damaging 1.00
R1653:Celsr2 UTSW 3 108,320,836 (GRCm39) missense possibly damaging 0.52
R1659:Celsr2 UTSW 3 108,321,411 (GRCm39) missense probably benign
R1689:Celsr2 UTSW 3 108,314,620 (GRCm39) missense possibly damaging 0.63
R1848:Celsr2 UTSW 3 108,308,626 (GRCm39) missense probably benign 0.35
R1859:Celsr2 UTSW 3 108,303,946 (GRCm39) missense probably damaging 1.00
R1918:Celsr2 UTSW 3 108,305,966 (GRCm39) missense probably benign 0.05
R1974:Celsr2 UTSW 3 108,321,530 (GRCm39) missense probably damaging 1.00
R2042:Celsr2 UTSW 3 108,309,811 (GRCm39) missense probably damaging 0.98
R2167:Celsr2 UTSW 3 108,320,509 (GRCm39) missense probably damaging 0.96
R2333:Celsr2 UTSW 3 108,305,921 (GRCm39) missense probably benign 0.16
R2434:Celsr2 UTSW 3 108,311,795 (GRCm39) missense probably damaging 1.00
R2504:Celsr2 UTSW 3 108,320,907 (GRCm39) missense probably benign 0.11
R3420:Celsr2 UTSW 3 108,321,732 (GRCm39) missense probably benign 0.03
R3712:Celsr2 UTSW 3 108,308,155 (GRCm39) missense probably benign
R3723:Celsr2 UTSW 3 108,304,731 (GRCm39) splice site probably benign
R3809:Celsr2 UTSW 3 108,310,555 (GRCm39) missense possibly damaging 0.67
R4018:Celsr2 UTSW 3 108,302,281 (GRCm39) missense possibly damaging 0.92
R4126:Celsr2 UTSW 3 108,309,413 (GRCm39) missense possibly damaging 0.71
R4177:Celsr2 UTSW 3 108,321,294 (GRCm39) missense probably damaging 0.96
R4232:Celsr2 UTSW 3 108,321,088 (GRCm39) missense probably benign 0.02
R4293:Celsr2 UTSW 3 108,300,993 (GRCm39) missense probably benign 0.01
R4458:Celsr2 UTSW 3 108,302,313 (GRCm39) missense probably damaging 0.98
R4621:Celsr2 UTSW 3 108,302,532 (GRCm39) missense possibly damaging 0.86
R4645:Celsr2 UTSW 3 108,303,285 (GRCm39) missense probably damaging 1.00
R4700:Celsr2 UTSW 3 108,304,547 (GRCm39) missense probably benign 0.24
R4732:Celsr2 UTSW 3 108,306,268 (GRCm39) missense probably damaging 0.99
R4733:Celsr2 UTSW 3 108,306,268 (GRCm39) missense probably damaging 0.99
R4901:Celsr2 UTSW 3 108,314,303 (GRCm39) missense possibly damaging 0.81
R4932:Celsr2 UTSW 3 108,310,074 (GRCm39) missense probably damaging 1.00
R4989:Celsr2 UTSW 3 108,319,945 (GRCm39) missense possibly damaging 0.62
R5052:Celsr2 UTSW 3 108,319,674 (GRCm39) missense probably damaging 1.00
R5093:Celsr2 UTSW 3 108,320,689 (GRCm39) missense possibly damaging 0.66
R5114:Celsr2 UTSW 3 108,301,312 (GRCm39) missense probably benign 0.05
R5120:Celsr2 UTSW 3 108,300,436 (GRCm39) missense probably benign 0.02
R5135:Celsr2 UTSW 3 108,305,975 (GRCm39) missense probably damaging 1.00
R5247:Celsr2 UTSW 3 108,304,946 (GRCm39) missense probably benign 0.34
R5381:Celsr2 UTSW 3 108,310,073 (GRCm39) missense probably damaging 1.00
R5412:Celsr2 UTSW 3 108,307,311 (GRCm39) missense probably damaging 1.00
R5445:Celsr2 UTSW 3 108,299,974 (GRCm39) missense probably benign 0.01
R5528:Celsr2 UTSW 3 108,320,610 (GRCm39) missense probably damaging 1.00
R5598:Celsr2 UTSW 3 108,310,119 (GRCm39) missense possibly damaging 0.82
R5652:Celsr2 UTSW 3 108,304,051 (GRCm39) missense probably null 0.49
R5697:Celsr2 UTSW 3 108,311,237 (GRCm39) nonsense probably null
R5718:Celsr2 UTSW 3 108,300,674 (GRCm39) missense probably benign
R5869:Celsr2 UTSW 3 108,321,225 (GRCm39) missense probably damaging 1.00
R5876:Celsr2 UTSW 3 108,321,259 (GRCm39) missense probably damaging 0.96
R6021:Celsr2 UTSW 3 108,308,561 (GRCm39) missense probably benign
R6054:Celsr2 UTSW 3 108,314,279 (GRCm39) missense possibly damaging 0.95
R6244:Celsr2 UTSW 3 108,300,444 (GRCm39) missense probably damaging 0.96
R6313:Celsr2 UTSW 3 108,308,530 (GRCm39) missense probably damaging 0.99
R6322:Celsr2 UTSW 3 108,319,890 (GRCm39) missense probably damaging 1.00
R6555:Celsr2 UTSW 3 108,302,235 (GRCm39) missense probably damaging 1.00
R6682:Celsr2 UTSW 3 108,307,817 (GRCm39) critical splice donor site probably null
R7062:Celsr2 UTSW 3 108,309,826 (GRCm39) missense possibly damaging 0.95
R7110:Celsr2 UTSW 3 108,305,181 (GRCm39) missense probably damaging 1.00
R7139:Celsr2 UTSW 3 108,322,675 (GRCm39) missense unknown
R7425:Celsr2 UTSW 3 108,309,773 (GRCm39) missense probably damaging 1.00
R7452:Celsr2 UTSW 3 108,320,406 (GRCm39) missense possibly damaging 0.95
R7461:Celsr2 UTSW 3 108,302,956 (GRCm39) missense probably damaging 1.00
R7502:Celsr2 UTSW 3 108,306,218 (GRCm39) missense probably benign 0.00
R7613:Celsr2 UTSW 3 108,302,956 (GRCm39) missense probably damaging 1.00
R7644:Celsr2 UTSW 3 108,320,806 (GRCm39) missense probably damaging 0.99
R7666:Celsr2 UTSW 3 108,305,904 (GRCm39) missense probably benign
R7687:Celsr2 UTSW 3 108,305,085 (GRCm39) missense probably benign 0.27
R7695:Celsr2 UTSW 3 108,310,069 (GRCm39) missense probably damaging 1.00
R8002:Celsr2 UTSW 3 108,311,285 (GRCm39) missense probably damaging 1.00
R8052:Celsr2 UTSW 3 108,319,971 (GRCm39) missense probably damaging 1.00
R8283:Celsr2 UTSW 3 108,303,771 (GRCm39) missense probably damaging 1.00
R8356:Celsr2 UTSW 3 108,320,847 (GRCm39) missense possibly damaging 0.90
R8381:Celsr2 UTSW 3 108,302,952 (GRCm39) missense probably damaging 1.00
R8427:Celsr2 UTSW 3 108,299,949 (GRCm39) makesense probably null
R8435:Celsr2 UTSW 3 108,321,715 (GRCm39) missense probably benign
R8438:Celsr2 UTSW 3 108,301,139 (GRCm39) missense probably damaging 1.00
R8458:Celsr2 UTSW 3 108,306,218 (GRCm39) missense probably benign 0.00
R8460:Celsr2 UTSW 3 108,304,093 (GRCm39) missense possibly damaging 0.84
R8462:Celsr2 UTSW 3 108,320,167 (GRCm39) nonsense probably null
R8479:Celsr2 UTSW 3 108,306,218 (GRCm39) missense probably benign 0.00
R8480:Celsr2 UTSW 3 108,306,218 (GRCm39) missense probably benign 0.00
R8512:Celsr2 UTSW 3 108,321,154 (GRCm39) missense probably damaging 1.00
R8694:Celsr2 UTSW 3 108,314,176 (GRCm39) missense probably damaging 1.00
R8772:Celsr2 UTSW 3 108,304,389 (GRCm39) missense possibly damaging 0.84
R8843:Celsr2 UTSW 3 108,303,443 (GRCm39) splice site probably benign
R8888:Celsr2 UTSW 3 108,320,880 (GRCm39) missense possibly damaging 0.95
R8895:Celsr2 UTSW 3 108,320,880 (GRCm39) missense possibly damaging 0.95
R8917:Celsr2 UTSW 3 108,303,882 (GRCm39) missense probably benign 0.00
R9119:Celsr2 UTSW 3 108,309,288 (GRCm39) missense possibly damaging 0.90
R9169:Celsr2 UTSW 3 108,309,862 (GRCm39) missense probably benign 0.04
R9209:Celsr2 UTSW 3 108,321,349 (GRCm39) missense probably benign 0.02
R9342:Celsr2 UTSW 3 108,320,442 (GRCm39) missense probably damaging 1.00
R9416:Celsr2 UTSW 3 108,322,084 (GRCm39) missense probably damaging 0.96
R9493:Celsr2 UTSW 3 108,301,074 (GRCm39) missense probably damaging 1.00
R9564:Celsr2 UTSW 3 108,321,834 (GRCm39) missense probably damaging 1.00
R9598:Celsr2 UTSW 3 108,322,578 (GRCm39) missense possibly damaging 0.72
R9629:Celsr2 UTSW 3 108,308,915 (GRCm39) missense probably damaging 1.00
R9691:Celsr2 UTSW 3 108,301,551 (GRCm39) missense probably damaging 1.00
X0020:Celsr2 UTSW 3 108,303,426 (GRCm39) missense probably damaging 1.00
X0050:Celsr2 UTSW 3 108,308,588 (GRCm39) missense probably benign 0.09
Z1088:Celsr2 UTSW 3 108,321,433 (GRCm39) missense probably damaging 1.00
Z1176:Celsr2 UTSW 3 108,319,657 (GRCm39) missense probably benign 0.07
Z1176:Celsr2 UTSW 3 108,300,447 (GRCm39) missense probably benign 0.10
Z1177:Celsr2 UTSW 3 108,320,887 (GRCm39) missense probably benign 0.32
Z1177:Celsr2 UTSW 3 108,319,536 (GRCm39) missense probably damaging 1.00
Z1191:Celsr2 UTSW 3 108,321,865 (GRCm39) missense possibly damaging 0.68
Predicted Primers PCR Primer
(F):5'- CCTCCTAACATGAAGGTGTGCAG -3'
(R):5'- CACTGCTCTCTGTCAACAGTG -3'

Sequencing Primer
(F):5'- CCTAACATGAAGGTGTGCAGAGATG -3'
(R):5'- TCAACAGTGACACTCTGCTC -3'
Posted On 2019-09-13