Mutagenetix > Incidental Mutation

Incidental Mutation 'R7326:Celsr2'

568873

Institutional Source

Beutler Lab

Gene Symbol

Celsr2

Ensembl Gene

ENSMUSG00000068740

Gene Name

cadherin, EGF LAG seven-pass G-type receptor 2

Synonyms

mfmi1, EGFL2, flamingo

MMRRC Submission

Accession Numbers

Genbank: NM_017392.3, NM_001004177.2 ; Ensembl: ENSMUST00000090558

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R7326 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

108390851-108415552 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to C at 108394995 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Phenylalanine to Valine at position 2606 (F2606V)

Ref Sequence

ENSEMBL: ENSMUSP00000088046 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000090558]

AlphaFold

no structure available at present

Predicted Effect

possibly damaging
Transcript: ENSMUST00000090558
AA Change: F2606V

PolyPhen 2 Score 0.852 (Sensitivity: 0.83; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000088046
Gene: ENSMUSG00000068740
AA Change: F2606V

Domain	Start	End	E-Value	Type
signal peptide	1	31	N/A	INTRINSIC
low complexity region	35	53	N/A	INTRINSIC
CA	203	287	1.36e-26	SMART
CA	311	397	1.33e-29	SMART
CA	421	503	2.59e-27	SMART
CA	527	608	3.33e-30	SMART
CA	632	710	5.18e-18	SMART
CA	734	813	1.08e-29	SMART
CA	837	919	8.08e-29	SMART
low complexity region	920	932	N/A	INTRINSIC
CA	943	1021	4.3e-24	SMART
CA	1049	1125	1.87e-1	SMART
low complexity region	1188	1198	N/A	INTRINSIC
EGF	1231	1286	1.81e-3	SMART
EGF_CA	1288	1324	2.24e-8	SMART
EGF	1331	1366	6.65e-2	SMART
LamG	1387	1554	8.4e-30	SMART
EGF	1577	1610	8e-5	SMART
LamG	1636	1770	1.56e-24	SMART
EGF	1796	1829	2.35e-2	SMART
EGF	1831	1867	3.88e-3	SMART
TNFR	1908	1943	1.35e-1	SMART
EGF_Lam	1924	1969	9.54e-12	SMART
HormR	1972	2034	1.57e-20	SMART
Pfam:GAIN	2046	2289	3e-62	PFAM
GPS	2315	2368	1.86e-25	SMART
Pfam:7tm_2	2373	2605	1.1e-48	PFAM
low complexity region	2715	2733	N/A	INTRINSIC
low complexity region	2857	2873	N/A	INTRINSIC
low complexity region	2874	2881	N/A	INTRINSIC

Predicted Effect

SMART Domains

Protein: ENSMUSP00000122329
Gene: ENSMUSG00000068740
AA Change: F594V

Domain	Start	End	E-Value	Type
Pfam:GAIN	35	278	5.1e-63	PFAM
GPS	304	357	1.86e-25	SMART
Pfam:7tm_2	362	594	2e-49	PFAM
low complexity region	704	722	N/A	INTRINSIC
low complexity region	846	862	N/A	INTRINSIC
low complexity region	863	870	N/A	INTRINSIC

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.8%
20x: 99.2%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the flamingo subfamily, part of the cadherin superfamily. The flamingo subfamily consists of nonclassic-type cadherins; a subpopulation that does not interact with catenins. The flamingo cadherins are located at the plasma membrane and have nine cadherin domains, seven epidermal growth factor-like repeats and two laminin A G-type repeats in their ectodomain. They also have seven transmembrane domains, a characteristic unique to this subfamily. It is postulated that these proteins are receptors involved in contact-mediated communication, with cadherin domains acting as homophilic binding regions and the EGF-like domains involved in cell adhesion and receptor-ligand interactions. The specific function of this particular member has not been determined. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for disruptions in this allele have mild to moderately dilated lateral ventricles in the brain but are otherwise normal. [provided by MGI curators]

Allele List at MGI

All alleles(4) : Targeted, knock-out(1) Targeted, other(3)

Other mutations in this stock

Total: 112 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
6430531B16Rik	A	T	7: 139,978,545		probably null	Het
Abcb4	T	C	5: 8,934,226	V652A	probably benign	Het
Acvrl1	G	T	15: 101,141,072	V417L	probably damaging	Het
Add1	A	G	5: 34,619,371	R479G	probably benign	Het
Adgb	A	T	10: 10,400,574	L350Q	possibly damaging	Het
Adgrl2	A	T	3: 148,846,870	S666T	probably benign	Het
Akap9	T	A	5: 4,045,930	D2268E	possibly damaging	Het
Amigo3	C	A	9: 108,054,066	H229Q	probably benign	Het
Ano6	G	C	15: 95,864,244	Q31H	possibly damaging	Het
Ap4m1	G	A	5: 138,175,019	D180N	probably damaging	Het
Apc2	A	T	10: 80,311,740	D876V	probably damaging	Het
Apcdd1	T	A	18: 62,952,188	Y485*	probably null	Het
Aqp1	G	T	6: 55,336,851	D121Y	probably benign	Het
Bicd2	C	A	13: 49,369,609	R141S	probably benign	Het
Brpf3	C	A	17: 28,806,293	H113Q	probably benign	Het
Cacng2	A	T	15: 78,013,320	Y96*	probably null	Het
Catsperg1	G	T	7: 29,210,759	N52K	possibly damaging	Het
Cerkl	A	T	2: 79,332,605	N516K	probably benign	Het
Ciita	G	A	16: 10,512,288	R812H	probably damaging	Het
Cldn3	T	A	5: 134,986,983	L180Q	probably damaging	Het
Cnot6l	T	C	5: 96,077,299	I512V	probably benign	Het
Col5a2	A	T	1: 45,442,867	D32E	unknown	Het
Coro7	A	G	16: 4,632,048	V616A	probably damaging	Het
Cyp4f18	T	C	8: 71,988,654	D494G	probably benign	Het
Ddx39	T	A	8: 83,722,471	V296E	probably benign	Het
Dgkg	A	T	16: 22,548,690	H593Q	probably damaging	Het
Dhx16	T	C	17: 35,886,160	L645P	probably damaging	Het
Dnah14	A	G	1: 181,598,403	M171V	probably benign	Het
Dnhd1	G	A	7: 105,720,930	V4521I	probably damaging	Het
Dok7	A	T	5: 35,064,522	M60L	probably benign	Het
Donson	A	T	16: 91,688,711	M1K	probably null	Het
Dsp	C	T	13: 38,192,883	T1548M	probably benign	Het
Dyrk1a	A	G	16: 94,692,043	T712A	probably damaging	Het
Eef2	A	G	10: 81,181,282	T708A	probably benign	Het
Epn3	G	A	11: 94,493,780	T289I	probably benign	Het
Fam171a1	C	T	2: 3,226,472	R881*	probably null	Het
Fam71a	G	A	1: 191,164,353	T31M	probably benign	Het
Fat2	T	A	11: 55,282,304	R2528W	probably damaging	Het
Fgfr1	T	G	8: 25,573,839	F707C	probably damaging	Het
Frem2	G	C	3: 53,654,753	P778A	probably damaging	Het
Ganc	A	G	2: 120,430,599	Y255C	probably damaging	Het
Ginm1	A	T	10: 7,777,850	Y65*	probably null	Het
Gm11559	T	A	11: 99,864,881	C119S	unknown	Het
Gnai1	T	A	5: 18,289,551	H188L		Het
H6pd	C	T	4: 149,996,350	A13T	probably benign	Het
Hist1h2be	T	C	13: 23,585,923	K12E	probably benign	Het
Hoxd12	A	T	2: 74,675,246	T54S	possibly damaging	Het
Hs3st5	T	A	10: 36,833,194	L242M	probably damaging	Het
Il9r	C	A	11: 32,194,389	V139L	possibly damaging	Het
Immt	A	G	6: 71,846,369	D68G	probably damaging	Het
Itsn2	A	G	12: 4,632,985	I304V	unknown	Het
Lgr4	G	A	2: 109,996,629	W159*	probably null	Het
Lin52	G	A	12: 84,457,954	G38S	probably damaging	Het
Lpgat1	A	T	1: 191,719,453	M64L	probably benign	Het
Lrrc10b	G	T	19: 10,456,778	R180S	possibly damaging	Het
Lrrc29	T	C	8: 105,312,898	D127G	probably damaging	Het
Lrrc36	A	T	8: 105,449,769	L258F	possibly damaging	Het
Ltbp4	T	A	7: 27,329,755	Q235L	unknown	Het
Maml2	A	G	9: 13,621,607	M706V		Het
Mc5r	G	T	18: 68,339,668	C366F	probably damaging	Het
Mlip	T	C	9: 77,164,842	R244G	probably benign	Het
Muc16	T	A	9: 18,585,013	R6658S	probably benign	Het
Mup4	G	T	4: 59,960,046	H73N	possibly damaging	Het
Nf1	A	G	11: 79,564,943	M565V	probably benign	Het
Nphp1	G	A	2: 127,761,217	T382I	possibly damaging	Het
Nrcam	C	T	12: 44,564,026	T503I	possibly damaging	Het
Nwd2	A	T	5: 63,800,409	N361Y	probably damaging	Het
Olfr1045	A	G	2: 86,198,573	Y60H	probably damaging	Het
Olfr1309	A	T	2: 111,983,327	L249*	probably null	Het
Olfr308	A	G	7: 86,321,574	I126T	probably damaging	Het
Olfr461	G	T	6: 40,544,895	A28E	probably damaging	Het
Olfr518	A	T	7: 108,880,816	H263Q	probably damaging	Het
Olfr836	A	G	9: 19,121,669	Y235C	probably benign	Het
Olfr993	A	T	2: 85,414,444	V145E	probably damaging	Het
Orc5	A	G	5: 22,523,584	F308L	probably benign	Het
Padi1	T	A	4: 140,832,404	Y54F	probably benign	Het
Parp1	A	G	1: 180,569,100	K23E	possibly damaging	Het
Pate1	A	T	9: 35,685,972	V79D	possibly damaging	Het
Pcdh18	T	C	3: 49,756,860	H2R	probably benign	Het
Pcnx2	G	A	8: 125,887,083	S543F	probably damaging	Het
Pcp4l1	G	A	1: 171,174,465	A42V	possibly damaging	Het
Pnkp	T	A	7: 44,859,734	F169L	probably damaging	Het
Ppp6r3	A	T	19: 3,507,325	N254K	probably damaging	Het
Psd	A	G	19: 46,324,454	L159P	probably benign	Het
Ptprf	A	G	4: 118,231,669	Y646H	probably damaging	Het
Rab3ip	A	T	10: 116,937,633	S92T	probably benign	Het
Rabgef1	A	G	5: 130,187,351		probably benign	Het
Ralgapa1	C	A	12: 55,709,004	W1129L	probably damaging	Het
Rhpn2	T	A	7: 35,385,463	L594Q	probably benign	Het
Rnf38	C	A	4: 44,158,989		probably benign	Het
Ryr2	T	A	13: 11,738,194	H1747L	possibly damaging	Het
Sec16a	A	G	2: 26,439,717	L13P	unknown	Het
Sppl3	C	A	5: 115,082,335	T102K	probably damaging	Het
Srgap2	A	T	1: 131,291,613	Y264*	probably null	Het
Stxbp2	T	C	8: 3,641,151	M465T		Het
Sumf2	A	G	5: 129,862,710	K305R	probably benign	Het
Susd2	T	A	10: 75,642,565	Y59F	probably benign	Het
Taco1	T	C	11: 106,072,617	V198A	probably benign	Het
Tas2r136	A	T	6: 132,777,906	M86K	possibly damaging	Het
Tbc1d10c	T	C	19: 4,184,898	E388G	possibly damaging	Het
Tmem132c	C	T	5: 127,564,059	T1098I	possibly damaging	Het
Trim3	G	T	7: 105,617,800	Y457*	probably null	Het
Ttc38	A	G	15: 85,852,861	T316A	probably benign	Het
Ubqln4	T	A	3: 88,555,910	N127K	probably benign	Het
Wdr91	A	T	6: 34,904,626	F262Y	probably damaging	Het
Zdhhc6	A	T	19: 55,302,755	C343S	possibly damaging	Het
Zfp248	A	G	6: 118,430,209	C140R	probably damaging	Het
Zfp266	T	C	9: 20,502,095	T90A	probably benign	Het
Zfp407	A	T	18: 84,559,042	D1315E	possibly damaging	Het
Zfp644	T	C	5: 106,638,277	S135G	probably benign	Het
Zscan29	A	T	2: 121,160,988	I773N	probably damaging	Het
Zswim5	T	A	4: 116,980,834	V787E	possibly damaging	Het

Other mutations in Celsr2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00898:Celsr2	APN	3	108413879	missense	possibly damaging	0.49
IGL01020:Celsr2	APN	3	108403270	missense	probably damaging	0.99
IGL01420:Celsr2	APN	3	108393763	missense	probably benign	0.13
IGL01448:Celsr2	APN	3	108393239	missense	probably damaging	0.99
IGL01559:Celsr2	APN	3	108406867	missense	possibly damaging	0.75
IGL01674:Celsr2	APN	3	108414843	missense	probably damaging	1.00
IGL01863:Celsr2	APN	3	108394022	missense	probably benign	0.00
IGL02309:Celsr2	APN	3	108396011	missense	probably damaging	1.00
IGL02325:Celsr2	APN	3	108412871	missense	probably damaging	1.00
IGL02409:Celsr2	APN	3	108413955	missense	probably damaging	1.00
IGL02514:Celsr2	APN	3	108397510	missense	probably benign	0.01
IGL02812:Celsr2	APN	3	108414113	missense	probably benign	0.25
IGL02894:Celsr2	APN	3	108395210	missense	probably damaging	1.00
IGL03281:Celsr2	APN	3	108412940	missense	probably damaging	1.00
barrow	UTSW	3	108394965	missense	possibly damaging	0.92
goldeneye	UTSW	3	108394919	missense	probably damaging	1.00
1mM(1):Celsr2	UTSW	3	108400838	missense	probably benign	0.01
ANU74:Celsr2	UTSW	3	108412499	missense	probably damaging	1.00
IGL02799:Celsr2	UTSW	3	108414062	missense	probably damaging	1.00
R0011:Celsr2	UTSW	3	108413402	missense	probably benign	0.19
R0031:Celsr2	UTSW	3	108413063	missense	probably damaging	1.00
R0049:Celsr2	UTSW	3	108397254	missense	probably benign	0.12
R0049:Celsr2	UTSW	3	108397254	missense	probably benign	0.12
R0090:Celsr2	UTSW	3	108393327	splice site	probably benign
R0140:Celsr2	UTSW	3	108397933	missense	probably benign	0.00
R0524:Celsr2	UTSW	3	108401587	missense	probably damaging	1.00
R0607:Celsr2	UTSW	3	108403895	critical splice donor site	probably null
R0662:Celsr2	UTSW	3	108398520	missense	probably damaging	0.99
R0690:Celsr2	UTSW	3	108414977	missense	probably damaging	1.00
R0691:Celsr2	UTSW	3	108412623	missense	probably damaging	1.00
R0710:Celsr2	UTSW	3	108412712	missense	probably benign	0.42
R0730:Celsr2	UTSW	3	108398606	missense	probably damaging	1.00
R0815:Celsr2	UTSW	3	108401301	missense	possibly damaging	0.56
R0848:Celsr2	UTSW	3	108414338	missense	probably benign
R0989:Celsr2	UTSW	3	108403272	missense	probably benign	0.00
R1185:Celsr2	UTSW	3	108399709	missense	possibly damaging	0.95
R1185:Celsr2	UTSW	3	108399709	missense	possibly damaging	0.95
R1185:Celsr2	UTSW	3	108399709	missense	possibly damaging	0.95
R1469:Celsr2	UTSW	3	108414108	missense	probably damaging	1.00
R1469:Celsr2	UTSW	3	108414108	missense	probably damaging	1.00
R1474:Celsr2	UTSW	3	108393739	missense	possibly damaging	0.91
R1608:Celsr2	UTSW	3	108402483	missense	probably damaging	1.00
R1653:Celsr2	UTSW	3	108413520	missense	possibly damaging	0.52
R1659:Celsr2	UTSW	3	108414095	missense	probably benign
R1689:Celsr2	UTSW	3	108407304	missense	possibly damaging	0.63
R1848:Celsr2	UTSW	3	108401310	missense	probably benign	0.35
R1859:Celsr2	UTSW	3	108396630	missense	probably damaging	1.00
R1918:Celsr2	UTSW	3	108398650	missense	probably benign	0.05
R1974:Celsr2	UTSW	3	108414214	missense	probably damaging	1.00
R2042:Celsr2	UTSW	3	108402495	missense	probably damaging	0.98
R2167:Celsr2	UTSW	3	108413193	missense	probably damaging	0.96
R2333:Celsr2	UTSW	3	108398605	missense	probably benign	0.16
R2434:Celsr2	UTSW	3	108404479	missense	probably damaging	1.00
R2504:Celsr2	UTSW	3	108413591	missense	probably benign	0.11
R3420:Celsr2	UTSW	3	108414416	missense	probably benign	0.03
R3712:Celsr2	UTSW	3	108400839	missense	probably benign
R3723:Celsr2	UTSW	3	108397415	splice site	probably benign
R3809:Celsr2	UTSW	3	108403239	missense	possibly damaging	0.67
R4018:Celsr2	UTSW	3	108394965	missense	possibly damaging	0.92
R4126:Celsr2	UTSW	3	108402097	missense	possibly damaging	0.71
R4177:Celsr2	UTSW	3	108413978	missense	probably damaging	0.96
R4232:Celsr2	UTSW	3	108413772	missense	probably benign	0.02
R4293:Celsr2	UTSW	3	108393677	missense	probably benign	0.01
R4458:Celsr2	UTSW	3	108394997	missense	probably damaging	0.98
R4621:Celsr2	UTSW	3	108395216	missense	possibly damaging	0.86
R4645:Celsr2	UTSW	3	108395969	missense	probably damaging	1.00
R4700:Celsr2	UTSW	3	108397231	missense	probably benign	0.24
R4732:Celsr2	UTSW	3	108398952	missense	probably damaging	0.99
R4733:Celsr2	UTSW	3	108398952	missense	probably damaging	0.99
R4901:Celsr2	UTSW	3	108406987	missense	possibly damaging	0.81
R4932:Celsr2	UTSW	3	108402758	missense	probably damaging	1.00
R4989:Celsr2	UTSW	3	108412629	missense	possibly damaging	0.62
R5052:Celsr2	UTSW	3	108412358	missense	probably damaging	1.00
R5093:Celsr2	UTSW	3	108413373	missense	possibly damaging	0.66
R5114:Celsr2	UTSW	3	108393996	missense	probably benign	0.05
R5120:Celsr2	UTSW	3	108393120	missense	probably benign	0.02
R5135:Celsr2	UTSW	3	108398659	missense	probably damaging	1.00
R5247:Celsr2	UTSW	3	108397630	missense	probably benign	0.34
R5381:Celsr2	UTSW	3	108402757	missense	probably damaging	1.00
R5412:Celsr2	UTSW	3	108399995	missense	probably damaging	1.00
R5445:Celsr2	UTSW	3	108392658	missense	probably benign	0.01
R5528:Celsr2	UTSW	3	108413294	missense	probably damaging	1.00
R5598:Celsr2	UTSW	3	108402803	missense	possibly damaging	0.82
R5652:Celsr2	UTSW	3	108396735	missense	probably null	0.49
R5697:Celsr2	UTSW	3	108403921	nonsense	probably null
R5718:Celsr2	UTSW	3	108393358	missense	probably benign
R5869:Celsr2	UTSW	3	108413909	missense	probably damaging	1.00
R5876:Celsr2	UTSW	3	108413943	missense	probably damaging	0.96
R6021:Celsr2	UTSW	3	108401245	missense	probably benign
R6054:Celsr2	UTSW	3	108406963	missense	possibly damaging	0.95
R6244:Celsr2	UTSW	3	108393128	missense	probably damaging	0.96
R6313:Celsr2	UTSW	3	108401214	missense	probably damaging	0.99
R6322:Celsr2	UTSW	3	108412574	missense	probably damaging	1.00
R6555:Celsr2	UTSW	3	108394919	missense	probably damaging	1.00
R6682:Celsr2	UTSW	3	108400501	critical splice donor site	probably null
R7062:Celsr2	UTSW	3	108402510	missense	possibly damaging	0.95
R7110:Celsr2	UTSW	3	108397865	missense	probably damaging	1.00
R7139:Celsr2	UTSW	3	108415359	missense	unknown
R7425:Celsr2	UTSW	3	108402457	missense	probably damaging	1.00
R7452:Celsr2	UTSW	3	108413090	missense	possibly damaging	0.95
R7461:Celsr2	UTSW	3	108395640	missense	probably damaging	1.00
R7502:Celsr2	UTSW	3	108398902	missense	probably benign	0.00
R7613:Celsr2	UTSW	3	108395640	missense	probably damaging	1.00
R7644:Celsr2	UTSW	3	108413490	missense	probably damaging	0.99
R7666:Celsr2	UTSW	3	108398588	missense	probably benign
R7687:Celsr2	UTSW	3	108397769	missense	probably benign	0.27
R7695:Celsr2	UTSW	3	108402753	missense	probably damaging	1.00
R8002:Celsr2	UTSW	3	108403969	missense	probably damaging	1.00
R8052:Celsr2	UTSW	3	108412655	missense	probably damaging	1.00
R8283:Celsr2	UTSW	3	108396455	missense	probably damaging	1.00
R8356:Celsr2	UTSW	3	108413531	missense	possibly damaging	0.90
R8381:Celsr2	UTSW	3	108395636	missense	probably damaging	1.00
R8427:Celsr2	UTSW	3	108392633	makesense	probably null
R8435:Celsr2	UTSW	3	108414399	missense	probably benign
R8438:Celsr2	UTSW	3	108393823	missense	probably damaging	1.00
R8458:Celsr2	UTSW	3	108398902	missense	probably benign	0.00
R8460:Celsr2	UTSW	3	108396777	missense	possibly damaging	0.84
R8462:Celsr2	UTSW	3	108412851	nonsense	probably null
R8479:Celsr2	UTSW	3	108398902	missense	probably benign	0.00
R8480:Celsr2	UTSW	3	108398902	missense	probably benign	0.00
R8512:Celsr2	UTSW	3	108413838	missense	probably damaging	1.00
R8694:Celsr2	UTSW	3	108406860	missense	probably damaging	1.00
R8772:Celsr2	UTSW	3	108397073	missense	possibly damaging	0.84
R8843:Celsr2	UTSW	3	108396127	splice site	probably benign
R8888:Celsr2	UTSW	3	108413564	missense	possibly damaging	0.95
R8895:Celsr2	UTSW	3	108413564	missense	possibly damaging	0.95
R8917:Celsr2	UTSW	3	108396566	missense	probably benign	0.00
R9119:Celsr2	UTSW	3	108401972	missense	possibly damaging	0.90
R9169:Celsr2	UTSW	3	108402546	missense	probably benign	0.04
R9209:Celsr2	UTSW	3	108414033	missense	probably benign	0.02
R9342:Celsr2	UTSW	3	108413126	missense	probably damaging	1.00
R9416:Celsr2	UTSW	3	108414768	missense	probably damaging	0.96
R9493:Celsr2	UTSW	3	108393758	missense	probably damaging	1.00
R9564:Celsr2	UTSW	3	108414518	missense	probably damaging	1.00
R9598:Celsr2	UTSW	3	108415262	missense	possibly damaging	0.72
R9629:Celsr2	UTSW	3	108401599	missense	probably damaging	1.00
R9691:Celsr2	UTSW	3	108394235	missense	probably damaging	1.00
X0020:Celsr2	UTSW	3	108396110	missense	probably damaging	1.00
X0050:Celsr2	UTSW	3	108401272	missense	probably benign	0.09
Z1088:Celsr2	UTSW	3	108414117	missense	probably damaging	1.00
Z1176:Celsr2	UTSW	3	108393131	missense	probably benign	0.10
Z1176:Celsr2	UTSW	3	108412341	missense	probably benign	0.07
Z1177:Celsr2	UTSW	3	108412220	missense	probably damaging	1.00
Z1177:Celsr2	UTSW	3	108413571	missense	probably benign	0.32
Z1191:Celsr2	UTSW	3	108414549	missense	possibly damaging	0.68

Predicted Primers

PCR Primer
(F):5'- CCTCCTAACATGAAGGTGTGCAG -3'
(R):5'- CACTGCTCTCTGTCAACAGTG -3'

Sequencing Primer
(F):5'- CCTAACATGAAGGTGTGCAGAGATG -3'
(R):5'- TCAACAGTGACACTCTGCTC -3'

Posted On

2019-09-13