Mutagenetix > Incidental Mutations

Incidental Mutation 'R7326:Abcb4'

568882

Institutional Source

Beutler Lab

Gene Symbol

Abcb4

Ensembl Gene

ENSMUSG00000042476

Gene Name

ATP-binding cassette, sub-family B (MDR/TAP), member 4

Synonyms

Pgy-2, Mdr2, Pgy2, mdr-2

MMRRC Submission

Accession Numbers

Ncbi RefSeq: NM_008830; MGI: 97569

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R7326 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

8893717-8959231 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 8934226 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Valine to Alanine at position 652 (V652A)

Ref Sequence

ENSEMBL: ENSMUSP00000003717 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000003717] [ENSMUST00000196067]

AlphaFold

P21440

Predicted Effect

probably benign
Transcript: ENSMUST00000003717
AA Change: V652A

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)

SMART Domains

Protein: ENSMUSP00000003717
Gene: ENSMUSG00000042476
AA Change: V652A

Domain	Start	End	E-Value	Type
Pfam:ABC_membrane	54	342	2e-94	PFAM
AAA	418	610	3.97e-20	SMART
Pfam:ABC_membrane	708	982	6.3e-77	PFAM
AAA	1058	1246	4.49e-19	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000196067
AA Change: V652A

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)

SMART Domains

Protein: ENSMUSP00000142425
Gene: ENSMUSG00000042476
AA Change: V652A

Domain	Start	End	E-Value	Type
Pfam:ABC_membrane	54	344	2.4e-95	PFAM
AAA	418	610	6.2e-22	SMART
Pfam:ABC_membrane	708	882	1.6e-37	PFAM

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.8%
20x: 99.2%

Validation Efficiency

MGI Phenotype

Strain: 1857236
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The membrane-associated protein encoded by this gene is a member of the superfamily of ATP-binding cassette (ABC) transporters. ABC proteins transport various molecules across extra- and intra-cellular membranes. ABC genes are divided into seven distinct subfamilies (ABC1, MDR/TAP, MRP, ALD, OABP, GCN20, White). This protein is a member of the MDR/TAP subfamily. Members of the MDR/TAP subfamily are involved in multidrug resistance as well as antigen presentation. This gene encodes a full transporter and member of the p-glycoprotein family of membrane proteins with phosphatidylcholine as its substrate. The function of this protein has not yet been determined; however, it may involve transport of phospholipids from liver hepatocytes into bile. Alternative splicing of this gene results in several products of undetermined function. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for targeted mutations that inactivate the gene are unable to secrete phospholipids into bile, leading to progressive hepatic disease, with an end stage of 3 months. [provided by MGI curators]

Allele List at MGI

All alleles(3) : Targeted(3)

Other mutations in this stock

Total: 112 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
6430531B16Rik	A	T	7: 139,978,545		probably null	Het
Acvrl1	G	T	15: 101,141,072	V417L	probably damaging	Het
Add1	A	G	5: 34,619,371	R479G	probably benign	Het
Adgb	A	T	10: 10,400,574	L350Q	possibly damaging	Het
Adgrl2	A	T	3: 148,846,870	S666T	probably benign	Het
Akap9	T	A	5: 4,045,930	D2268E	possibly damaging	Het
Amigo3	C	A	9: 108,054,066	H229Q	probably benign	Het
Ano6	G	C	15: 95,864,244	Q31H	possibly damaging	Het
Ap4m1	G	A	5: 138,175,019	D180N	probably damaging	Het
Apc2	A	T	10: 80,311,740	D876V	probably damaging	Het
Apcdd1	T	A	18: 62,952,188	Y485*	probably null	Het
Aqp1	G	T	6: 55,336,851	D121Y	probably benign	Het
Bicd2	C	A	13: 49,369,609	R141S	probably benign	Het
Brpf3	C	A	17: 28,806,293	H113Q	probably benign	Het
Cacng2	A	T	15: 78,013,320	Y96*	probably null	Het
Catsperg1	G	T	7: 29,210,759	N52K	possibly damaging	Het
Celsr2	A	C	3: 108,394,995	F2606V	possibly damaging	Het
Cerkl	A	T	2: 79,332,605	N516K	probably benign	Het
Ciita	G	A	16: 10,512,288	R812H	probably damaging	Het
Cldn3	T	A	5: 134,986,983	L180Q	probably damaging	Het
Cnot6l	T	C	5: 96,077,299	I512V	probably benign	Het
Col5a2	A	T	1: 45,442,867	D32E	unknown	Het
Coro7	A	G	16: 4,632,048	V616A	probably damaging	Het
Cyp4f18	T	C	8: 71,988,654	D494G	probably benign	Het
Ddx39	T	A	8: 83,722,471	V296E	probably benign	Het
Dgkg	A	T	16: 22,548,690	H593Q	probably damaging	Het
Dhx16	T	C	17: 35,886,160	L645P	probably damaging	Het
Dnah14	A	G	1: 181,598,403	M171V	probably benign	Het
Dnhd1	G	A	7: 105,720,930	V4521I	probably damaging	Het
Dok7	A	T	5: 35,064,522	M60L	probably benign	Het
Donson	A	T	16: 91,688,711	M1K	probably null	Het
Dsp	C	T	13: 38,192,883	T1548M	probably benign	Het
Dyrk1a	A	G	16: 94,692,043	T712A	probably damaging	Het
Eef2	A	G	10: 81,181,282	T708A	probably benign	Het
Epn3	G	A	11: 94,493,780	T289I	probably benign	Het
Fam171a1	C	T	2: 3,226,472	R881*	probably null	Het
Fam71a	G	A	1: 191,164,353	T31M	probably benign	Het
Fat2	T	A	11: 55,282,304	R2528W	probably damaging	Het
Fgfr1	T	G	8: 25,573,839	F707C	probably damaging	Het
Frem2	G	C	3: 53,654,753	P778A	probably damaging	Het
Ganc	A	G	2: 120,430,599	Y255C	probably damaging	Het
Ginm1	A	T	10: 7,777,850	Y65*	probably null	Het
Gm11559	T	A	11: 99,864,881	C119S	unknown	Het
Gnai1	T	A	5: 18,289,551	H188L		Het
H6pd	C	T	4: 149,996,350	A13T	probably benign	Het
Hist1h2be	T	C	13: 23,585,923	K12E	probably benign	Het
Hoxd12	A	T	2: 74,675,246	T54S	possibly damaging	Het
Hs3st5	T	A	10: 36,833,194	L242M	probably damaging	Het
Il9r	C	A	11: 32,194,389	V139L	possibly damaging	Het
Immt	A	G	6: 71,846,369	D68G	probably damaging	Het
Itsn2	A	G	12: 4,632,985	I304V	unknown	Het
Lgr4	G	A	2: 109,996,629	W159*	probably null	Het
Lin52	G	A	12: 84,457,954	G38S	probably damaging	Het
Lpgat1	A	T	1: 191,719,453	M64L	probably benign	Het
Lrrc10b	G	T	19: 10,456,778	R180S	possibly damaging	Het
Lrrc29	T	C	8: 105,312,898	D127G	probably damaging	Het
Lrrc36	A	T	8: 105,449,769	L258F	possibly damaging	Het
Ltbp4	T	A	7: 27,329,755	Q235L	unknown	Het
Maml2	A	G	9: 13,621,607	M706V		Het
Mc5r	G	T	18: 68,339,668	C366F	probably damaging	Het
Mlip	T	C	9: 77,164,842	R244G	probably benign	Het
Muc16	T	A	9: 18,585,013	R6658S	probably benign	Het
Mup4	G	T	4: 59,960,046	H73N	possibly damaging	Het
Nf1	A	G	11: 79,564,943	M565V	probably benign	Het
Nphp1	G	A	2: 127,761,217	T382I	possibly damaging	Het
Nrcam	C	T	12: 44,564,026	T503I	possibly damaging	Het
Nwd2	A	T	5: 63,800,409	N361Y	probably damaging	Het
Olfr1045	A	G	2: 86,198,573	Y60H	probably damaging	Het
Olfr1309	A	T	2: 111,983,327	L249*	probably null	Het
Olfr308	A	G	7: 86,321,574	I126T	probably damaging	Het
Olfr461	G	T	6: 40,544,895	A28E	probably damaging	Het
Olfr518	A	T	7: 108,880,816	H263Q	probably damaging	Het
Olfr836	A	G	9: 19,121,669	Y235C	probably benign	Het
Olfr993	A	T	2: 85,414,444	V145E	probably damaging	Het
Orc5	A	G	5: 22,523,584	F308L	probably benign	Het
Padi1	T	A	4: 140,832,404	Y54F	probably benign	Het
Parp1	A	G	1: 180,569,100	K23E	possibly damaging	Het
Pate1	A	T	9: 35,685,972	V79D	possibly damaging	Het
Pcdh18	T	C	3: 49,756,860	H2R	probably benign	Het
Pcnx2	G	A	8: 125,887,083	S543F	probably damaging	Het
Pcp4l1	G	A	1: 171,174,465	A42V	possibly damaging	Het
Pnkp	T	A	7: 44,859,734	F169L	probably damaging	Het
Ppp6r3	A	T	19: 3,507,325	N254K	probably damaging	Het
Psd	A	G	19: 46,324,454	L159P	probably benign	Het
Ptprf	A	G	4: 118,231,669	Y646H	probably damaging	Het
Rab3ip	A	T	10: 116,937,633	S92T	probably benign	Het
Rabgef1	A	G	5: 130,187,351		probably benign	Het
Ralgapa1	C	A	12: 55,709,004	W1129L	probably damaging	Het
Rhpn2	T	A	7: 35,385,463	L594Q	probably benign	Het
Rnf38	C	A	4: 44,158,989		probably benign	Het
Ryr2	T	A	13: 11,738,194	H1747L	possibly damaging	Het
Sec16a	A	G	2: 26,439,717	L13P	unknown	Het
Sppl3	C	A	5: 115,082,335	T102K	probably damaging	Het
Srgap2	A	T	1: 131,291,613	Y264*	probably null	Het
Stxbp2	T	C	8: 3,641,151	M465T		Het
Sumf2	A	G	5: 129,862,710	K305R	probably benign	Het
Susd2	T	A	10: 75,642,565	Y59F	probably benign	Het
Taco1	T	C	11: 106,072,617	V198A	probably benign	Het
Tas2r136	A	T	6: 132,777,906	M86K	possibly damaging	Het
Tbc1d10c	T	C	19: 4,184,898	E388G	possibly damaging	Het
Tmem132c	C	T	5: 127,564,059	T1098I	possibly damaging	Het
Trim3	G	T	7: 105,617,800	Y457*	probably null	Het
Ttc38	A	G	15: 85,852,861	T316A	probably benign	Het
Ubqln4	T	A	3: 88,555,910	N127K	probably benign	Het
Wdr91	A	T	6: 34,904,626	F262Y	probably damaging	Het
Zdhhc6	A	T	19: 55,302,755	C343S	possibly damaging	Het
Zfp248	A	G	6: 118,430,209	C140R	probably damaging	Het
Zfp266	T	C	9: 20,502,095	T90A	probably benign	Het
Zfp407	A	T	18: 84,559,042	D1315E	possibly damaging	Het
Zfp644	T	C	5: 106,638,277	S135G	probably benign	Het
Zscan29	A	T	2: 121,160,988	I773N	probably damaging	Het
Zswim5	T	A	4: 116,980,834	V787E	possibly damaging	Het

Other mutations in Abcb4

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00570:Abcb4	APN	5	8950073	missense	probably benign	0.02
IGL00663:Abcb4	APN	5	8927916	missense	probably damaging	1.00
IGL00671:Abcb4	APN	5	8930745	nonsense	probably null
IGL00822:Abcb4	APN	5	8950046	missense	probably benign
IGL01080:Abcb4	APN	5	8934258	missense	probably damaging	1.00
IGL01152:Abcb4	APN	5	8950678	missense	probably benign	0.19
IGL01329:Abcb4	APN	5	8894166	critical splice donor site	probably null
IGL01483:Abcb4	APN	5	8927871	missense	probably damaging	0.99
IGL01594:Abcb4	APN	5	8946071	splice site	probably null
IGL01785:Abcb4	APN	5	8915058	nonsense	probably null
IGL01968:Abcb4	APN	5	8927913	missense	probably benign	0.33
IGL02579:Abcb4	APN	5	8955537	missense	probably damaging	1.00
IGL02654:Abcb4	APN	5	8927826	missense	possibly damaging	0.80
IGL02658:Abcb4	APN	5	8934240	missense	probably benign
IGL03229:Abcb4	APN	5	8940936	missense	probably damaging	0.97
IGL03335:Abcb4	APN	5	8935258	missense	probably benign	0.00
FR4737:Abcb4	UTSW	5	8896597	small deletion	probably benign
P0014:Abcb4	UTSW	5	8950083	missense	probably benign	0.01
R0102:Abcb4	UTSW	5	8909194	missense	probably damaging	0.99
R0102:Abcb4	UTSW	5	8909194	missense	probably damaging	0.99
R0309:Abcb4	UTSW	5	8939835	missense	probably damaging	1.00
R0311:Abcb4	UTSW	5	8934243	missense	probably benign
R0420:Abcb4	UTSW	5	8941050	missense	probably benign	0.03
R0449:Abcb4	UTSW	5	8939885	nonsense	probably null
R0609:Abcb4	UTSW	5	8947376	missense	probably damaging	0.96
R1459:Abcb4	UTSW	5	8918662	missense	possibly damaging	0.61
R1470:Abcb4	UTSW	5	8940968	missense	probably damaging	0.98
R1470:Abcb4	UTSW	5	8940968	missense	probably damaging	0.98
R1812:Abcb4	UTSW	5	8928578	critical splice donor site	probably null
R1944:Abcb4	UTSW	5	8930796	missense	probably damaging	1.00
R2002:Abcb4	UTSW	5	8905989	missense	probably benign	0.01
R2256:Abcb4	UTSW	5	8958431	missense	probably damaging	1.00
R3116:Abcb4	UTSW	5	8896610	missense	possibly damaging	0.86
R4112:Abcb4	UTSW	5	8936783	critical splice acceptor site	probably null
R4354:Abcb4	UTSW	5	8918771	missense	probably benign	0.44
R4512:Abcb4	UTSW	5	8928573	missense	probably damaging	1.00
R4588:Abcb4	UTSW	5	8947328	missense	probably benign	0.01
R4628:Abcb4	UTSW	5	8907399	missense	probably benign	0.08
R4708:Abcb4	UTSW	5	8915125	missense	possibly damaging	0.90
R4714:Abcb4	UTSW	5	8930906	splice site	probably null
R4754:Abcb4	UTSW	5	8910717	missense	probably damaging	1.00
R4846:Abcb4	UTSW	5	8935180	missense	probably benign
R4896:Abcb4	UTSW	5	8907267	missense	possibly damaging	0.81
R4944:Abcb4	UTSW	5	8934327	critical splice donor site	probably null
R4994:Abcb4	UTSW	5	8928524	missense	probably damaging	1.00
R5022:Abcb4	UTSW	5	8909054	splice site	probably null
R5537:Abcb4	UTSW	5	8955485	missense	probably damaging	0.98
R5754:Abcb4	UTSW	5	8934320	missense	probably benign
R5833:Abcb4	UTSW	5	8958314	missense	probably damaging	1.00
R5934:Abcb4	UTSW	5	8930806	missense	probably benign	0.18
R6006:Abcb4	UTSW	5	8946026	missense	probably damaging	0.99
R6146:Abcb4	UTSW	5	8896587	missense	probably benign	0.05
R6183:Abcb4	UTSW	5	8918718	missense	probably benign
R6260:Abcb4	UTSW	5	8934219	nonsense	probably null
R6561:Abcb4	UTSW	5	8927825	missense	probably benign	0.14
R7016:Abcb4	UTSW	5	8936843	missense	probably benign	0.35
R7081:Abcb4	UTSW	5	8934263	missense	probably benign
R7375:Abcb4	UTSW	5	8918671	missense	probably benign
R7787:Abcb4	UTSW	5	8909220	missense	probably damaging	1.00
R7836:Abcb4	UTSW	5	8934203	missense	probably benign
R8128:Abcb4	UTSW	5	8958395	missense	probably damaging	1.00
R8350:Abcb4	UTSW	5	8928578	critical splice donor site	probably null
R8438:Abcb4	UTSW	5	8946120	critical splice donor site	probably null
R8447:Abcb4	UTSW	5	8907278	missense	probably damaging	0.97
R8710:Abcb4	UTSW	5	8955495	missense	probably damaging	1.00
R8777:Abcb4	UTSW	5	8939894	missense	probably benign	0.01
R8777-TAIL:Abcb4	UTSW	5	8939894	missense	probably benign	0.01
R8837:Abcb4	UTSW	5	8936873	missense	probably damaging	0.99
R8987:Abcb4	UTSW	5	8927931	missense	probably benign	0.02
R9098:Abcb4	UTSW	5	8958441	missense	probably damaging	1.00
R9167:Abcb4	UTSW	5	8936849	nonsense	probably null
R9210:Abcb4	UTSW	5	8955591	missense	probably damaging	1.00
R9212:Abcb4	UTSW	5	8955591	missense	probably damaging	1.00
R9218:Abcb4	UTSW	5	8927960	missense	probably benign	0.20
R9242:Abcb4	UTSW	5	8899677	missense	probably damaging	1.00
R9376:Abcb4	UTSW	5	8958988	missense	probably damaging	1.00
RF015:Abcb4	UTSW	5	8896594	frame shift	probably null
RF047:Abcb4	UTSW	5	8896595	frame shift	probably null
Z1176:Abcb4	UTSW	5	8959005	missense	probably damaging	1.00
Z1177:Abcb4	UTSW	5	8939906	nonsense	probably null

Predicted Primers

PCR Primer
(F):5'- TCCTTGATTTCAAACCTCAACCTAG -3'
(R):5'- AAGAGTCATGTGCTCTTTAGGGC -3'

Sequencing Primer
(F):5'- CCATGTGGACATATTCACA -3'
(R):5'- GGCTAAAGATTTCAGTAGCAAAACTC -3'

Posted On

2019-09-13