Incidental Mutation 'R7326:Cldn3'
ID568894
Institutional Source Beutler Lab
Gene Symbol Cldn3
Ensembl Gene ENSMUSG00000070473
Gene Nameclaudin 3
SynonymsCpetr2
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.207) question?
Stock #R7326 (G1)
Quality Score225.009
Status Not validated
Chromosome5
Chromosomal Location134986214-134987472 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 134986983 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Glutamine at position 180 (L180Q)
Ref Sequence ENSEMBL: ENSMUSP00000091799 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000094245]
Predicted Effect probably damaging
Transcript: ENSMUST00000094245
AA Change: L180Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000091799
Gene: ENSMUSG00000070473
AA Change: L180Q

DomainStartEndE-ValueType
Pfam:PMP22_Claudin 3 180 1.8e-35 PFAM
Pfam:Claudin_2 10 182 4.6e-12 PFAM
low complexity region 203 211 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a member of the claudin family. Claudins are integral membrane proteins and components of tight junction strands. Tight junction strands serve as a physical barrier to prevent solutes and water from passing freely through the paracellular space between epithelial or endothelial cell sheets, and also play critical roles in maintaining cell polarity and signal transductions. The protein encoded by this gene is a low-affinity receptor for clostridium perfringens enterotoxin (CPE) produced by the bacterium Clostridium perfringens, and the interaction with CPE results in increased membrane permeability by forming small pores in plasma membrane. This protein is highly overexpressed in uterine carcinosarcoma. This protein is also predominantly present in brain endothelial cells, where it plays a specific role in the establishment and maintenance of blood brain barrier tight junction morphology. [provided by RefSeq, Aug 2012]
PHENOTYPE: Mice homozygous for a null allele are fertile with mutant males exhibiting normal spermatogenesis and fully functional Sertoli cell tight junctions. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 112 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
6430531B16Rik A T 7: 139,978,545 probably null Het
Abcb4 T C 5: 8,934,226 V652A probably benign Het
Acvrl1 G T 15: 101,141,072 V417L probably damaging Het
Add1 A G 5: 34,619,371 R479G probably benign Het
Adgb A T 10: 10,400,574 L350Q possibly damaging Het
Adgrl2 A T 3: 148,846,870 S666T probably benign Het
Akap9 T A 5: 4,045,930 D2268E possibly damaging Het
Amigo3 C A 9: 108,054,066 H229Q probably benign Het
Ano6 G C 15: 95,864,244 Q31H possibly damaging Het
Ap4m1 G A 5: 138,175,019 D180N probably damaging Het
Apc2 A T 10: 80,311,740 D876V probably damaging Het
Apcdd1 T A 18: 62,952,188 Y485* probably null Het
Aqp1 G T 6: 55,336,851 D121Y probably benign Het
Bicd2 C A 13: 49,369,609 R141S probably benign Het
Brpf3 C A 17: 28,806,293 H113Q probably benign Het
Cacng2 A T 15: 78,013,320 Y96* probably null Het
Catsperg1 G T 7: 29,210,759 N52K possibly damaging Het
Celsr2 A C 3: 108,394,995 F2606V possibly damaging Het
Cerkl A T 2: 79,332,605 N516K probably benign Het
Ciita G A 16: 10,512,288 R812H probably damaging Het
Cnot6l T C 5: 96,077,299 I512V probably benign Het
Col5a2 A T 1: 45,442,867 D32E unknown Het
Coro7 A G 16: 4,632,048 V616A probably damaging Het
Cyp4f18 T C 8: 71,988,654 D494G probably benign Het
Ddx39 T A 8: 83,722,471 V296E probably benign Het
Dgkg A T 16: 22,548,690 H593Q probably damaging Het
Dhx16 T C 17: 35,886,160 L645P probably damaging Het
Dnah14 A G 1: 181,598,403 M171V probably benign Het
Dnhd1 G A 7: 105,720,930 V4521I probably damaging Het
Dok7 A T 5: 35,064,522 M60L probably benign Het
Donson A T 16: 91,688,711 M1K probably null Het
Dsp C T 13: 38,192,883 T1548M probably benign Het
Dyrk1a A G 16: 94,692,043 T712A probably damaging Het
Eef2 A G 10: 81,181,282 T708A probably benign Het
Epn3 G A 11: 94,493,780 T289I probably benign Het
Fam171a1 C T 2: 3,226,472 R881* probably null Het
Fam71a G A 1: 191,164,353 T31M probably benign Het
Fat2 T A 11: 55,282,304 R2528W probably damaging Het
Fgfr1 T G 8: 25,573,839 F707C probably damaging Het
Frem2 G C 3: 53,654,753 P778A probably damaging Het
Ganc A G 2: 120,430,599 Y255C probably damaging Het
Ginm1 A T 10: 7,777,850 Y65* probably null Het
Gm11559 T A 11: 99,864,881 C119S unknown Het
Gnai1 T A 5: 18,289,551 H188L Het
H6pd C T 4: 149,996,350 A13T probably benign Het
Hist1h2be T C 13: 23,585,923 K12E probably benign Het
Hoxd12 A T 2: 74,675,246 T54S possibly damaging Het
Hs3st5 T A 10: 36,833,194 L242M probably damaging Het
Il9r C A 11: 32,194,389 V139L possibly damaging Het
Immt A G 6: 71,846,369 D68G probably damaging Het
Itsn2 A G 12: 4,632,985 I304V unknown Het
Lgr4 G A 2: 109,996,629 W159* probably null Het
Lin52 G A 12: 84,457,954 G38S probably damaging Het
Lpgat1 A T 1: 191,719,453 M64L probably benign Het
Lrrc10b G T 19: 10,456,778 R180S possibly damaging Het
Lrrc29 T C 8: 105,312,898 D127G probably damaging Het
Lrrc36 A T 8: 105,449,769 L258F possibly damaging Het
Ltbp4 T A 7: 27,329,755 Q235L unknown Het
Maml2 A G 9: 13,621,607 M706V Het
Mc5r G T 18: 68,339,668 C366F probably damaging Het
Mlip T C 9: 77,164,842 R244G probably benign Het
Muc16 T A 9: 18,585,013 R6658S probably benign Het
Mup4 G T 4: 59,960,046 H73N possibly damaging Het
Nf1 A G 11: 79,564,943 M565V probably benign Het
Nphp1 G A 2: 127,761,217 T382I possibly damaging Het
Nrcam C T 12: 44,564,026 T503I possibly damaging Het
Nwd2 A T 5: 63,800,409 N361Y probably damaging Het
Olfr1045 A G 2: 86,198,573 Y60H probably damaging Het
Olfr1309 A T 2: 111,983,327 L249* probably null Het
Olfr308 A G 7: 86,321,574 I126T probably damaging Het
Olfr461 G T 6: 40,544,895 A28E probably damaging Het
Olfr518 A T 7: 108,880,816 H263Q probably damaging Het
Olfr836 A G 9: 19,121,669 Y235C probably benign Het
Olfr993 A T 2: 85,414,444 V145E probably damaging Het
Orc5 A G 5: 22,523,584 F308L probably benign Het
Padi1 T A 4: 140,832,404 Y54F probably benign Het
Parp1 A G 1: 180,569,100 K23E possibly damaging Het
Pate1 A T 9: 35,685,972 V79D possibly damaging Het
Pcdh18 T C 3: 49,756,860 H2R probably benign Het
Pcnx2 G A 8: 125,887,083 S543F probably damaging Het
Pcp4l1 G A 1: 171,174,465 A42V possibly damaging Het
Pnkp T A 7: 44,859,734 F169L probably damaging Het
Ppp6r3 A T 19: 3,507,325 N254K probably damaging Het
Psd A G 19: 46,324,454 L159P probably benign Het
Ptprf A G 4: 118,231,669 Y646H probably damaging Het
Rab3ip A T 10: 116,937,633 S92T probably benign Het
Rabgef1 A G 5: 130,187,351 probably benign Het
Ralgapa1 C A 12: 55,709,004 W1129L probably damaging Het
Rhpn2 T A 7: 35,385,463 L594Q probably benign Het
Rnf38 C A 4: 44,158,989 probably benign Het
Ryr2 T A 13: 11,738,194 H1747L possibly damaging Het
Sec16a A G 2: 26,439,717 L13P unknown Het
Sppl3 C A 5: 115,082,335 T102K probably damaging Het
Srgap2 A T 1: 131,291,613 Y264* probably null Het
Stxbp2 T C 8: 3,641,151 M465T Het
Sumf2 A G 5: 129,862,710 K305R probably benign Het
Susd2 T A 10: 75,642,565 Y59F probably benign Het
Taco1 T C 11: 106,072,617 V198A probably benign Het
Tas2r136 A T 6: 132,777,906 M86K possibly damaging Het
Tbc1d10c T C 19: 4,184,898 E388G possibly damaging Het
Tmem132c C T 5: 127,564,059 T1098I possibly damaging Het
Trim3 G T 7: 105,617,800 Y457* probably null Het
Ttc38 A G 15: 85,852,861 T316A probably benign Het
Ubqln4 T A 3: 88,555,910 N127K probably benign Het
Wdr91 A T 6: 34,904,626 F262Y probably damaging Het
Zdhhc6 A T 19: 55,302,755 C343S possibly damaging Het
Zfp248 A G 6: 118,430,209 C140R probably damaging Het
Zfp266 T C 9: 20,502,095 T90A probably benign Het
Zfp407 A T 18: 84,559,042 D1315E possibly damaging Het
Zfp644 T C 5: 106,638,277 S135G probably benign Het
Zscan29 A T 2: 121,160,988 I773N probably damaging Het
Zswim5 T A 4: 116,980,834 V787E possibly damaging Het
Other mutations in Cldn3
AlleleSourceChrCoordTypePredicted EffectPPH Score
R6235:Cldn3 UTSW 5 134986719 missense possibly damaging 0.61
R6915:Cldn3 UTSW 5 134986572 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- GTGTACCAACTGCGTACAAGAC -3'
(R):5'- TCATCGACTGCTGGTAGTGG -3'

Sequencing Primer
(F):5'- AAGATCACCATCGTGGCG -3'
(R):5'- CGACTGCTGGTAGTGGTGACG -3'
Posted On2019-09-13