Mutagenetix > Incidental Mutation

Incidental Mutation 'R7326:Dnhd1'

568908

Institutional Source

Beutler Lab

Gene Symbol

Dnhd1

Ensembl Gene

ENSMUSG00000030882

Gene Name

dynein heavy chain domain 1

Synonyms

8030491N06Rik

MMRRC Submission

Accession Numbers

Variant 1:ENSMUST00000145988; OTTMUST00000062891; Variant 2: ENSMUST00000106773; Variant 3: ENSMUST00000106776; Variant 4: ENSMUST00000163171; Variant 5: ENSMUST00000142363;OTTMUST00000062869; Variant 6: ENSMUST00000142874; OTTMUST00000062870; Variant 7: ENSMUST00000128388; OTTMUST00000062892; MGI:1924755

Essential gene?

Probably non essential (E-score: 0.076) question?

Stock #

R7326 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

105650827-105721799 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to A at 105720930 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Valine to Isoleucine at position 4521 (V4521I)

Ref Sequence

ENSEMBL: ENSMUSP00000121261 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000145988]

AlphaFold

no structure available at present

Predicted Effect

probably damaging
Transcript: ENSMUST00000145988
AA Change: V4521I

PolyPhen 2 Score 0.959 (Sensitivity: 0.78; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000121261
Gene: ENSMUSG00000030882
AA Change: V4521I

Domain	Start	End	E-Value	Type
low complexity region	5	18	N/A	INTRINSIC
low complexity region	102	115	N/A	INTRINSIC
low complexity region	183	191	N/A	INTRINSIC
low complexity region	253	269	N/A	INTRINSIC
low complexity region	943	962	N/A	INTRINSIC
Pfam:DHC_N2	1018	1472	4.6e-50	PFAM
Pfam:AAA_6	1652	1875	2.7e-14	PFAM
low complexity region	1906	1918	N/A	INTRINSIC
Blast:AAA	1993	2196	1e-34	BLAST
Pfam:AAA_7	2362	2610	3.3e-11	PFAM
low complexity region	2697	2714	N/A	INTRINSIC
low complexity region	2722	2733	N/A	INTRINSIC
low complexity region	2800	2810	N/A	INTRINSIC
low complexity region	3116	3134	N/A	INTRINSIC
Pfam:MT	3178	3470	3.9e-16	PFAM
coiled coil region	3590	3642	N/A	INTRINSIC
coiled coil region	3816	3843	N/A	INTRINSIC
Pfam:Dynein_heavy	3976	4746	7.3e-97	PFAM

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.8%
20x: 99.2%

Validation Efficiency

Allele List at MGI

All alleles(1) : Gene trapped(1)

Other mutations in this stock

Total: 112 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
6430531B16Rik	A	T	7: 139,978,545		probably null	Het
Abcb4	T	C	5: 8,934,226	V652A	probably benign	Het
Acvrl1	G	T	15: 101,141,072	V417L	probably damaging	Het
Add1	A	G	5: 34,619,371	R479G	probably benign	Het
Adgb	A	T	10: 10,400,574	L350Q	possibly damaging	Het
Adgrl2	A	T	3: 148,846,870	S666T	probably benign	Het
Akap9	T	A	5: 4,045,930	D2268E	possibly damaging	Het
Amigo3	C	A	9: 108,054,066	H229Q	probably benign	Het
Ano6	G	C	15: 95,864,244	Q31H	possibly damaging	Het
Ap4m1	G	A	5: 138,175,019	D180N	probably damaging	Het
Apc2	A	T	10: 80,311,740	D876V	probably damaging	Het
Apcdd1	T	A	18: 62,952,188	Y485*	probably null	Het
Aqp1	G	T	6: 55,336,851	D121Y	probably benign	Het
Bicd2	C	A	13: 49,369,609	R141S	probably benign	Het
Brpf3	C	A	17: 28,806,293	H113Q	probably benign	Het
Cacng2	A	T	15: 78,013,320	Y96*	probably null	Het
Catsperg1	G	T	7: 29,210,759	N52K	possibly damaging	Het
Celsr2	A	C	3: 108,394,995	F2606V	possibly damaging	Het
Cerkl	A	T	2: 79,332,605	N516K	probably benign	Het
Ciita	G	A	16: 10,512,288	R812H	probably damaging	Het
Cldn3	T	A	5: 134,986,983	L180Q	probably damaging	Het
Cnot6l	T	C	5: 96,077,299	I512V	probably benign	Het
Col5a2	A	T	1: 45,442,867	D32E	unknown	Het
Coro7	A	G	16: 4,632,048	V616A	probably damaging	Het
Cyp4f18	T	C	8: 71,988,654	D494G	probably benign	Het
Ddx39	T	A	8: 83,722,471	V296E	probably benign	Het
Dgkg	A	T	16: 22,548,690	H593Q	probably damaging	Het
Dhx16	T	C	17: 35,886,160	L645P	probably damaging	Het
Dnah14	A	G	1: 181,598,403	M171V	probably benign	Het
Dok7	A	T	5: 35,064,522	M60L	probably benign	Het
Donson	A	T	16: 91,688,711	M1K	probably null	Het
Dsp	C	T	13: 38,192,883	T1548M	probably benign	Het
Dyrk1a	A	G	16: 94,692,043	T712A	probably damaging	Het
Eef2	A	G	10: 81,181,282	T708A	probably benign	Het
Epn3	G	A	11: 94,493,780	T289I	probably benign	Het
Fam171a1	C	T	2: 3,226,472	R881*	probably null	Het
Fam71a	G	A	1: 191,164,353	T31M	probably benign	Het
Fat2	T	A	11: 55,282,304	R2528W	probably damaging	Het
Fgfr1	T	G	8: 25,573,839	F707C	probably damaging	Het
Frem2	G	C	3: 53,654,753	P778A	probably damaging	Het
Ganc	A	G	2: 120,430,599	Y255C	probably damaging	Het
Ginm1	A	T	10: 7,777,850	Y65*	probably null	Het
Gm11559	T	A	11: 99,864,881	C119S	unknown	Het
Gnai1	T	A	5: 18,289,551	H188L		Het
H6pd	C	T	4: 149,996,350	A13T	probably benign	Het
Hist1h2be	T	C	13: 23,585,923	K12E	probably benign	Het
Hoxd12	A	T	2: 74,675,246	T54S	possibly damaging	Het
Hs3st5	T	A	10: 36,833,194	L242M	probably damaging	Het
Il9r	C	A	11: 32,194,389	V139L	possibly damaging	Het
Immt	A	G	6: 71,846,369	D68G	probably damaging	Het
Itsn2	A	G	12: 4,632,985	I304V	unknown	Het
Lgr4	G	A	2: 109,996,629	W159*	probably null	Het
Lin52	G	A	12: 84,457,954	G38S	probably damaging	Het
Lpgat1	A	T	1: 191,719,453	M64L	probably benign	Het
Lrrc10b	G	T	19: 10,456,778	R180S	possibly damaging	Het
Lrrc29	T	C	8: 105,312,898	D127G	probably damaging	Het
Lrrc36	A	T	8: 105,449,769	L258F	possibly damaging	Het
Ltbp4	T	A	7: 27,329,755	Q235L	unknown	Het
Maml2	A	G	9: 13,621,607	M706V		Het
Mc5r	G	T	18: 68,339,668	C366F	probably damaging	Het
Mlip	T	C	9: 77,164,842	R244G	probably benign	Het
Muc16	T	A	9: 18,585,013	R6658S	probably benign	Het
Mup4	G	T	4: 59,960,046	H73N	possibly damaging	Het
Nf1	A	G	11: 79,564,943	M565V	probably benign	Het
Nphp1	G	A	2: 127,761,217	T382I	possibly damaging	Het
Nrcam	C	T	12: 44,564,026	T503I	possibly damaging	Het
Nwd2	A	T	5: 63,800,409	N361Y	probably damaging	Het
Olfr1045	A	G	2: 86,198,573	Y60H	probably damaging	Het
Olfr1309	A	T	2: 111,983,327	L249*	probably null	Het
Olfr308	A	G	7: 86,321,574	I126T	probably damaging	Het
Olfr461	G	T	6: 40,544,895	A28E	probably damaging	Het
Olfr518	A	T	7: 108,880,816	H263Q	probably damaging	Het
Olfr836	A	G	9: 19,121,669	Y235C	probably benign	Het
Olfr993	A	T	2: 85,414,444	V145E	probably damaging	Het
Orc5	A	G	5: 22,523,584	F308L	probably benign	Het
Padi1	T	A	4: 140,832,404	Y54F	probably benign	Het
Parp1	A	G	1: 180,569,100	K23E	possibly damaging	Het
Pate1	A	T	9: 35,685,972	V79D	possibly damaging	Het
Pcdh18	T	C	3: 49,756,860	H2R	probably benign	Het
Pcnx2	G	A	8: 125,887,083	S543F	probably damaging	Het
Pcp4l1	G	A	1: 171,174,465	A42V	possibly damaging	Het
Pnkp	T	A	7: 44,859,734	F169L	probably damaging	Het
Ppp6r3	A	T	19: 3,507,325	N254K	probably damaging	Het
Psd	A	G	19: 46,324,454	L159P	probably benign	Het
Ptprf	A	G	4: 118,231,669	Y646H	probably damaging	Het
Rab3ip	A	T	10: 116,937,633	S92T	probably benign	Het
Rabgef1	A	G	5: 130,187,351		probably benign	Het
Ralgapa1	C	A	12: 55,709,004	W1129L	probably damaging	Het
Rhpn2	T	A	7: 35,385,463	L594Q	probably benign	Het
Rnf38	C	A	4: 44,158,989		probably benign	Het
Ryr2	T	A	13: 11,738,194	H1747L	possibly damaging	Het
Sec16a	A	G	2: 26,439,717	L13P	unknown	Het
Sppl3	C	A	5: 115,082,335	T102K	probably damaging	Het
Srgap2	A	T	1: 131,291,613	Y264*	probably null	Het
Stxbp2	T	C	8: 3,641,151	M465T		Het
Sumf2	A	G	5: 129,862,710	K305R	probably benign	Het
Susd2	T	A	10: 75,642,565	Y59F	probably benign	Het
Taco1	T	C	11: 106,072,617	V198A	probably benign	Het
Tas2r136	A	T	6: 132,777,906	M86K	possibly damaging	Het
Tbc1d10c	T	C	19: 4,184,898	E388G	possibly damaging	Het
Tmem132c	C	T	5: 127,564,059	T1098I	possibly damaging	Het
Trim3	G	T	7: 105,617,800	Y457*	probably null	Het
Ttc38	A	G	15: 85,852,861	T316A	probably benign	Het
Ubqln4	T	A	3: 88,555,910	N127K	probably benign	Het
Wdr91	A	T	6: 34,904,626	F262Y	probably damaging	Het
Zdhhc6	A	T	19: 55,302,755	C343S	possibly damaging	Het
Zfp248	A	G	6: 118,430,209	C140R	probably damaging	Het
Zfp266	T	C	9: 20,502,095	T90A	probably benign	Het
Zfp407	A	T	18: 84,559,042	D1315E	possibly damaging	Het
Zfp644	T	C	5: 106,638,277	S135G	probably benign	Het
Zscan29	A	T	2: 121,160,988	I773N	probably damaging	Het
Zswim5	T	A	4: 116,980,834	V787E	possibly damaging	Het

Other mutations in Dnhd1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00321:Dnhd1	APN	7	105677995	missense	probably damaging	1.00
IGL00516:Dnhd1	APN	7	105657211	missense	possibly damaging	0.52
IGL00576:Dnhd1	APN	7	105692675	missense	probably damaging	1.00
IGL00990:Dnhd1	APN	7	105721688	missense	possibly damaging	0.85
IGL01346:Dnhd1	APN	7	105713909	missense	probably benign
IGL01714:Dnhd1	APN	7	105720942	missense	probably damaging	1.00
IGL01735:Dnhd1	APN	7	105713754	missense	probably benign	0.37
IGL01814:Dnhd1	APN	7	105652030	missense	probably benign
IGL01999:Dnhd1	APN	7	105721215	missense	possibly damaging	0.50
IGL02022:Dnhd1	APN	7	105678309	missense	probably damaging	1.00
IGL02131:Dnhd1	APN	7	105720802	missense	probably damaging	1.00
IGL02156:Dnhd1	APN	7	105721744	missense	probably damaging	1.00
IGL02674:Dnhd1	APN	7	105721481	missense	probably benign	0.00
IGL02966:Dnhd1	APN	7	105720741	missense	probably benign	0.00
IGL03066:Dnhd1	APN	7	105719882	missense	probably damaging	0.99
IGL03298:Dnhd1	APN	7	105714475	missense	probably damaging	0.98
IGL03378:Dnhd1	APN	7	105713733	missense	possibly damaging	0.87
IGL02802:Dnhd1	UTSW	7	105655723	missense	possibly damaging	0.83
R0060:Dnhd1	UTSW	7	105668514	missense	probably damaging	0.99
R0129:Dnhd1	UTSW	7	105720924	missense	probably benign	0.19
R0238:Dnhd1	UTSW	7	105721531	missense	probably benign	0.06
R0238:Dnhd1	UTSW	7	105721531	missense	probably benign	0.06
R0239:Dnhd1	UTSW	7	105721531	missense	probably benign	0.06
R0239:Dnhd1	UTSW	7	105721531	missense	probably benign	0.06
R0384:Dnhd1	UTSW	7	105720114	missense	possibly damaging	0.56
R0453:Dnhd1	UTSW	7	105674444	missense	probably benign	0.00
R0540:Dnhd1	UTSW	7	105720788	missense	probably benign	0.04
R0554:Dnhd1	UTSW	7	105694395	missense	probably benign	0.10
R0576:Dnhd1	UTSW	7	105714045	missense	probably damaging	1.00
R0607:Dnhd1	UTSW	7	105720788	missense	probably benign	0.04
R0631:Dnhd1	UTSW	7	105651624	missense	probably benign	0.17
R0639:Dnhd1	UTSW	7	105696464	missense	possibly damaging	0.95
R0668:Dnhd1	UTSW	7	105695751	missense	probably benign
R0669:Dnhd1	UTSW	7	105693704	missense	probably benign	0.01
R0670:Dnhd1	UTSW	7	105696464	missense	possibly damaging	0.95
R0699:Dnhd1	UTSW	7	105651906	missense	probably damaging	0.98
R1019:Dnhd1	UTSW	7	105709171	missense	probably damaging	1.00
R1144:Dnhd1	UTSW	7	105713031	missense	probably damaging	1.00
R1226:Dnhd1	UTSW	7	105696899	missense	probably damaging	1.00
R1257:Dnhd1	UTSW	7	105694153	missense	probably damaging	1.00
R1391:Dnhd1	UTSW	7	105720124	missense	probably damaging	1.00
R1453:Dnhd1	UTSW	7	105721273	critical splice donor site	probably null
R1501:Dnhd1	UTSW	7	105668463	missense	probably benign	0.00
R1503:Dnhd1	UTSW	7	105693660	missense	possibly damaging	0.67
R1515:Dnhd1	UTSW	7	105704148	missense	probably benign	0.11
R1615:Dnhd1	UTSW	7	105703206	missense	probably benign	0.00
R1615:Dnhd1	UTSW	7	105713706	missense	possibly damaging	0.74
R1656:Dnhd1	UTSW	7	105714281	missense	probably damaging	1.00
R1720:Dnhd1	UTSW	7	105693828	missense	probably benign
R1723:Dnhd1	UTSW	7	105714920	missense	possibly damaging	0.60
R1766:Dnhd1	UTSW	7	105693972	missense	possibly damaging	0.50
R1799:Dnhd1	UTSW	7	105655767	missense	probably benign	0.31
R1860:Dnhd1	UTSW	7	105704205	missense	probably benign
R1920:Dnhd1	UTSW	7	105713407	missense	probably benign	0.00
R1925:Dnhd1	UTSW	7	105652252	missense	probably damaging	1.00
R1925:Dnhd1	UTSW	7	105673854	missense	probably damaging	0.96
R1934:Dnhd1	UTSW	7	105708582	missense	probably benign	0.05
R1935:Dnhd1	UTSW	7	105673976	missense	probably benign	0.09
R1936:Dnhd1	UTSW	7	105673976	missense	probably benign	0.09
R2035:Dnhd1	UTSW	7	105704921	missense	probably damaging	0.99
R2125:Dnhd1	UTSW	7	105677971	missense	probably benign	0.35
R2127:Dnhd1	UTSW	7	105693721	missense	possibly damaging	0.56
R2254:Dnhd1	UTSW	7	105703772	missense	probably damaging	1.00
R2301:Dnhd1	UTSW	7	105705399	missense	probably damaging	1.00
R2316:Dnhd1	UTSW	7	105674421	missense	probably damaging	1.00
R2324:Dnhd1	UTSW	7	105710090	missense	probably damaging	1.00
R2337:Dnhd1	UTSW	7	105703467	missense	probably benign	0.07
R2381:Dnhd1	UTSW	7	105693664	missense	probably benign	0.42
R2394:Dnhd1	UTSW	7	105720231	missense	probably benign	0.19
R2862:Dnhd1	UTSW	7	105712559	missense	probably benign	0.01
R3038:Dnhd1	UTSW	7	105720229	missense	probably damaging	0.99
R3114:Dnhd1	UTSW	7	105696565	critical splice donor site	probably null
R3404:Dnhd1	UTSW	7	105694761	nonsense	probably null
R3405:Dnhd1	UTSW	7	105694761	nonsense	probably null
R3439:Dnhd1	UTSW	7	105694785	missense	probably damaging	1.00
R3959:Dnhd1	UTSW	7	105713122	missense	probably benign	0.21
R4014:Dnhd1	UTSW	7	105714838	missense	probably damaging	0.99
R4084:Dnhd1	UTSW	7	105709588	missense	probably damaging	1.00
R4181:Dnhd1	UTSW	7	105693954	missense	probably damaging	1.00
R4255:Dnhd1	UTSW	7	105712998	missense	probably damaging	1.00
R4302:Dnhd1	UTSW	7	105693954	missense	probably damaging	1.00
R4440:Dnhd1	UTSW	7	105696728	nonsense	probably null
R4565:Dnhd1	UTSW	7	105651956	missense	possibly damaging	0.92
R4569:Dnhd1	UTSW	7	105657166	splice site	probably null
R4584:Dnhd1	UTSW	7	105678049	missense	probably damaging	1.00
R4586:Dnhd1	UTSW	7	105678049	missense	probably damaging	1.00
R4590:Dnhd1	UTSW	7	105714030	missense	probably damaging	1.00
R4593:Dnhd1	UTSW	7	105715446	missense	probably benign	0.02
R4600:Dnhd1	UTSW	7	105703644	missense	probably damaging	1.00
R4705:Dnhd1	UTSW	7	105655741	missense	probably damaging	1.00
R4731:Dnhd1	UTSW	7	105673849	missense	probably benign	0.00
R4732:Dnhd1	UTSW	7	105673849	missense	probably benign	0.00
R4733:Dnhd1	UTSW	7	105673849	missense	probably benign	0.00
R4786:Dnhd1	UTSW	7	105674444	missense	probably benign	0.00
R4791:Dnhd1	UTSW	7	105721117	missense	probably damaging	1.00
R4811:Dnhd1	UTSW	7	105714281	missense	probably damaging	0.99
R4822:Dnhd1	UTSW	7	105703964	missense	probably benign	0.00
R4886:Dnhd1	UTSW	7	105714808	missense	probably benign	0.00
R4890:Dnhd1	UTSW	7	105656957	missense	possibly damaging	0.47
R4973:Dnhd1	UTSW	7	105713633	missense	probably benign	0.24
R5007:Dnhd1	UTSW	7	105713076	missense	probably damaging	1.00
R5048:Dnhd1	UTSW	7	105693697	missense	probably benign	0.01
R5151:Dnhd1	UTSW	7	105713440	missense	probably benign	0.22
R5179:Dnhd1	UTSW	7	105714552	missense	probably damaging	1.00
R5182:Dnhd1	UTSW	7	105703209	missense	probably damaging	1.00
R5183:Dnhd1	UTSW	7	105703209	missense	probably damaging	1.00
R5185:Dnhd1	UTSW	7	105703209	missense	probably damaging	1.00
R5209:Dnhd1	UTSW	7	105696460	missense	probably benign	0.00
R5225:Dnhd1	UTSW	7	105703923	missense	possibly damaging	0.73
R5250:Dnhd1	UTSW	7	105685761	missense	probably damaging	1.00
R5257:Dnhd1	UTSW	7	105674037	missense	probably benign
R5258:Dnhd1	UTSW	7	105674037	missense	probably benign
R5273:Dnhd1	UTSW	7	105714482	missense	probably damaging	0.99
R5288:Dnhd1	UTSW	7	105714437	missense	possibly damaging	0.94
R5396:Dnhd1	UTSW	7	105713684	missense	probably benign	0.00
R5453:Dnhd1	UTSW	7	105710123	missense	probably damaging	1.00
R5511:Dnhd1	UTSW	7	105714156	missense	probably damaging	1.00
R5518:Dnhd1	UTSW	7	105703209	missense	probably damaging	1.00
R5523:Dnhd1	UTSW	7	105703209	missense	probably damaging	1.00
R5528:Dnhd1	UTSW	7	105703209	missense	probably damaging	1.00
R5529:Dnhd1	UTSW	7	105703209	missense	probably damaging	1.00
R5561:Dnhd1	UTSW	7	105714821	missense	probably damaging	0.99
R5681:Dnhd1	UTSW	7	105703209	missense	probably damaging	1.00
R5682:Dnhd1	UTSW	7	105703209	missense	probably damaging	1.00
R5683:Dnhd1	UTSW	7	105703209	missense	probably damaging	1.00
R5684:Dnhd1	UTSW	7	105703209	missense	probably damaging	1.00
R5686:Dnhd1	UTSW	7	105703209	missense	probably damaging	1.00
R5697:Dnhd1	UTSW	7	105674188	missense	probably damaging	1.00
R5789:Dnhd1	UTSW	7	105705010	missense	possibly damaging	0.50
R5790:Dnhd1	UTSW	7	105655774	missense	probably damaging	1.00
R5814:Dnhd1	UTSW	7	105719895	missense	possibly damaging	0.69
R5828:Dnhd1	UTSW	7	105720181	missense	probably benign	0.00
R5852:Dnhd1	UTSW	7	105695748	missense	probably damaging	1.00
R5883:Dnhd1	UTSW	7	105720504	missense	probably damaging	0.98
R6115:Dnhd1	UTSW	7	105713987	missense	probably benign	0.00
R6119:Dnhd1	UTSW	7	105709440	missense	probably benign	0.18
R6212:Dnhd1	UTSW	7	105704048	missense	probably damaging	1.00
R6243:Dnhd1	UTSW	7	105652009	missense	probably damaging	1.00
R6265:Dnhd1	UTSW	7	105693370	missense	probably benign	0.07
R6332:Dnhd1	UTSW	7	105694066	missense	probably benign	0.02
R6344:Dnhd1	UTSW	7	105694610	missense	probably benign	0.38
R6477:Dnhd1	UTSW	7	105677886	missense	probably benign	0.05
R6642:Dnhd1	UTSW	7	105703799	missense	probably benign
R6663:Dnhd1	UTSW	7	105685692	splice site	probably null
R6730:Dnhd1	UTSW	7	105703875	missense	probably benign	0.00
R6748:Dnhd1	UTSW	7	105720637	missense	probably benign	0.03
R6833:Dnhd1	UTSW	7	105703373	missense	probably benign	0.01
R6850:Dnhd1	UTSW	7	105719930	missense	possibly damaging	0.68
R6853:Dnhd1	UTSW	7	105703728	missense	probably benign
R6860:Dnhd1	UTSW	7	105678266	missense	probably benign
R6898:Dnhd1	UTSW	7	105687377	missense	probably damaging	0.99
R6927:Dnhd1	UTSW	7	105715563	missense	probably damaging	1.00
R6952:Dnhd1	UTSW	7	105713688	missense	probably damaging	1.00
R6987:Dnhd1	UTSW	7	105704585	missense	probably damaging	0.98
R6988:Dnhd1	UTSW	7	105714210	missense	probably damaging	1.00
R7022:Dnhd1	UTSW	7	105720798	missense	probably benign	0.36
R7053:Dnhd1	UTSW	7	105694954	missense	probably damaging	1.00
R7085:Dnhd1	UTSW	7	105715261	missense	probably benign	0.26
R7086:Dnhd1	UTSW	7	105708532	missense	probably benign	0.03
R7112:Dnhd1	UTSW	7	105713985	missense	probably damaging	1.00
R7140:Dnhd1	UTSW	7	105693766	missense	probably benign	0.00
R7151:Dnhd1	UTSW	7	105710027	missense	probably benign	0.03
R7178:Dnhd1	UTSW	7	105694993	missense	probably damaging	0.98
R7345:Dnhd1	UTSW	7	105703967	missense	probably benign	0.17
R7349:Dnhd1	UTSW	7	105710123	missense	probably damaging	1.00
R7397:Dnhd1	UTSW	7	105705297	missense	possibly damaging	0.87
R7520:Dnhd1	UTSW	7	105696048	missense	probably benign	0.07
R7536:Dnhd1	UTSW	7	105709561	missense	probably damaging	1.00
R7539:Dnhd1	UTSW	7	105720912	missense	probably damaging	1.00
R7541:Dnhd1	UTSW	7	105678309	missense	probably damaging	1.00
R7619:Dnhd1	UTSW	7	105674268	missense	probably benign	0.01
R7676:Dnhd1	UTSW	7	105684087	missense	probably benign	0.09
R7689:Dnhd1	UTSW	7	105713963	missense	probably benign	0.07
R7712:Dnhd1	UTSW	7	105651624	missense	probably benign	0.17
R7729:Dnhd1	UTSW	7	105705265	missense	probably damaging	1.00
R7767:Dnhd1	UTSW	7	105694610	missense	probably benign	0.38
R7768:Dnhd1	UTSW	7	105721095	missense	possibly damaging	0.87
R7779:Dnhd1	UTSW	7	105677915	missense	probably benign	0.01
R7879:Dnhd1	UTSW	7	105703439	missense	probably benign	0.09
R7922:Dnhd1	UTSW	7	105668514	missense	probably damaging	1.00
R7951:Dnhd1	UTSW	7	105678004	missense	probably damaging	1.00
R8259:Dnhd1	UTSW	7	105694788	missense	probably benign	0.38
R8350:Dnhd1	UTSW	7	105678024	missense	probably damaging	0.99
R8380:Dnhd1	UTSW	7	105677866	missense	probably benign	0.31
R8392:Dnhd1	UTSW	7	105703343	missense	possibly damaging	0.84
R8478:Dnhd1	UTSW	7	105682794	missense	probably benign	0.00
R8708:Dnhd1	UTSW	7	105694280	nonsense	probably null
R8767:Dnhd1	UTSW	7	105652123	missense	probably damaging	1.00
R8825:Dnhd1	UTSW	7	105693967	missense	possibly damaging	0.95
R8849:Dnhd1	UTSW	7	105721516	missense	probably benign	0.00
R8903:Dnhd1	UTSW	7	105713648	nonsense	probably null
R8910:Dnhd1	UTSW	7	105683697	missense	possibly damaging	0.92
R8940:Dnhd1	UTSW	7	105714647	intron	probably benign
R8954:Dnhd1	UTSW	7	105694779	missense	probably benign	0.35
R8956:Dnhd1	UTSW	7	105692645	missense	probably damaging	0.99
R8971:Dnhd1	UTSW	7	105709321	nonsense	probably null
R8996:Dnhd1	UTSW	7	105674035	missense	probably damaging	1.00
R9051:Dnhd1	UTSW	7	105692726	missense	possibly damaging	0.54
R9058:Dnhd1	UTSW	7	105684063	missense	probably benign	0.01
R9109:Dnhd1	UTSW	7	105683966	missense	probably damaging	0.98
R9284:Dnhd1	UTSW	7	105651884	missense	probably damaging	1.00
R9295:Dnhd1	UTSW	7	105714141	missense	probably benign
R9298:Dnhd1	UTSW	7	105683966	missense	probably damaging	0.98
R9299:Dnhd1	UTSW	7	105720599	missense	probably benign	0.00
R9308:Dnhd1	UTSW	7	105704277	missense	probably damaging	1.00
R9337:Dnhd1	UTSW	7	105720599	missense	probably benign	0.00
R9385:Dnhd1	UTSW	7	105712765	missense	probably damaging	1.00
R9463:Dnhd1	UTSW	7	105657247	missense	probably benign	0.00
R9463:Dnhd1	UTSW	7	105695016	missense	probably benign
R9476:Dnhd1	UTSW	7	105703682	missense	possibly damaging	0.74
R9489:Dnhd1	UTSW	7	105651597	missense	probably benign
R9500:Dnhd1	UTSW	7	105704502	missense	probably benign
R9510:Dnhd1	UTSW	7	105703682	missense	possibly damaging	0.74
R9513:Dnhd1	UTSW	7	105704972	missense	probably damaging	1.00
R9537:Dnhd1	UTSW	7	105695533	missense	probably damaging	0.99
R9567:Dnhd1	UTSW	7	105704266	missense	probably benign	0.03
R9622:Dnhd1	UTSW	7	105704135	missense	probably benign
R9623:Dnhd1	UTSW	7	105686566	missense	probably damaging	1.00
R9623:Dnhd1	UTSW	7	105694927	missense	probably damaging	1.00
R9674:Dnhd1	UTSW	7	105714222	missense	probably damaging	1.00
R9756:Dnhd1	UTSW	7	105703928	missense	probably benign	0.19
R9777:Dnhd1	UTSW	7	105720249	missense	probably benign	0.14
R9778:Dnhd1	UTSW	7	105704033	missense	probably benign
R9781:Dnhd1	UTSW	7	105703710	missense	probably benign	0.31
R9796:Dnhd1	UTSW	7	105693330	missense	probably damaging	1.00
Z1088:Dnhd1	UTSW	7	105712727	missense	probably benign	0.00
Z1176:Dnhd1	UTSW	7	105668547	missense	probably damaging	0.98
Z1176:Dnhd1	UTSW	7	105678299	missense	probably benign
Z1176:Dnhd1	UTSW	7	105703036	critical splice acceptor site	probably null
Z1176:Dnhd1	UTSW	7	105703580	frame shift	probably null
Z1177:Dnhd1	UTSW	7	105682841	missense	possibly damaging	0.90

Predicted Primers

PCR Primer
(F):5'- CTTCAGGCTTTGCTAACCAACAAC -3'
(R):5'- CCGACAGGTGAAATATGCGC -3'

Sequencing Primer
(F):5'- AACCGTATTCGCTCAGGC -3'
(R):5'- CAGGTGAAATATGCGCTCTGG -3'

Posted On

2019-09-13