Incidental Mutation 'R7326:Dnhd1'
ID568908
Institutional Source Beutler Lab
Gene Symbol Dnhd1
Ensembl Gene ENSMUSG00000030882
Gene Namedynein heavy chain domain 1
Synonyms8030491N06Rik
MMRRC Submission
Accession Numbers

Variant 1:ENSMUST00000145988; OTTMUST00000062891; Variant 2:  ENSMUST00000106773; Variant 3: ENSMUST00000106776; Variant 4: ENSMUST00000163171; Variant 5: ENSMUST00000142363;OTTMUST00000062869; Variant 6: ENSMUST00000142874; OTTMUST00000062870; Variant 7: ENSMUST00000128388; OTTMUST00000062892; MGI:1924755

Is this an essential gene? Probably non essential (E-score: 0.085) question?
Stock #R7326 (G1)
Quality Score225.009
Status Not validated
Chromosome7
Chromosomal Location105650827-105721799 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 105720930 bp
ZygosityHeterozygous
Amino Acid Change Valine to Isoleucine at position 4521 (V4521I)
Ref Sequence ENSEMBL: ENSMUSP00000121261 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000145988]
Predicted Effect probably damaging
Transcript: ENSMUST00000145988
AA Change: V4521I

PolyPhen 2 Score 0.959 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000121261
Gene: ENSMUSG00000030882
AA Change: V4521I

DomainStartEndE-ValueType
low complexity region 5 18 N/A INTRINSIC
low complexity region 102 115 N/A INTRINSIC
low complexity region 183 191 N/A INTRINSIC
low complexity region 253 269 N/A INTRINSIC
low complexity region 943 962 N/A INTRINSIC
Pfam:DHC_N2 1018 1472 4.6e-50 PFAM
Pfam:AAA_6 1652 1875 2.7e-14 PFAM
low complexity region 1906 1918 N/A INTRINSIC
Blast:AAA 1993 2196 1e-34 BLAST
Pfam:AAA_7 2362 2610 3.3e-11 PFAM
low complexity region 2697 2714 N/A INTRINSIC
low complexity region 2722 2733 N/A INTRINSIC
low complexity region 2800 2810 N/A INTRINSIC
low complexity region 3116 3134 N/A INTRINSIC
Pfam:MT 3178 3470 3.9e-16 PFAM
coiled coil region 3590 3642 N/A INTRINSIC
coiled coil region 3816 3843 N/A INTRINSIC
Pfam:Dynein_heavy 3976 4746 7.3e-97 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency
Allele List at MGI

All alleles(1) : Gene trapped(1)

Other mutations in this stock
Total: 112 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
6430531B16Rik A T 7: 139,978,545 probably null Het
Abcb4 T C 5: 8,934,226 V652A probably benign Het
Acvrl1 G T 15: 101,141,072 V417L probably damaging Het
Add1 A G 5: 34,619,371 R479G probably benign Het
Adgb A T 10: 10,400,574 L350Q possibly damaging Het
Adgrl2 A T 3: 148,846,870 S666T probably benign Het
Akap9 T A 5: 4,045,930 D2268E possibly damaging Het
Amigo3 C A 9: 108,054,066 H229Q probably benign Het
Ano6 G C 15: 95,864,244 Q31H possibly damaging Het
Ap4m1 G A 5: 138,175,019 D180N probably damaging Het
Apc2 A T 10: 80,311,740 D876V probably damaging Het
Apcdd1 T A 18: 62,952,188 Y485* probably null Het
Aqp1 G T 6: 55,336,851 D121Y probably benign Het
Bicd2 C A 13: 49,369,609 R141S probably benign Het
Brpf3 C A 17: 28,806,293 H113Q probably benign Het
Cacng2 A T 15: 78,013,320 Y96* probably null Het
Catsperg1 G T 7: 29,210,759 N52K possibly damaging Het
Celsr2 A C 3: 108,394,995 F2606V possibly damaging Het
Cerkl A T 2: 79,332,605 N516K probably benign Het
Ciita G A 16: 10,512,288 R812H probably damaging Het
Cldn3 T A 5: 134,986,983 L180Q probably damaging Het
Cnot6l T C 5: 96,077,299 I512V probably benign Het
Col5a2 A T 1: 45,442,867 D32E unknown Het
Coro7 A G 16: 4,632,048 V616A probably damaging Het
Cyp4f18 T C 8: 71,988,654 D494G probably benign Het
Ddx39 T A 8: 83,722,471 V296E probably benign Het
Dgkg A T 16: 22,548,690 H593Q probably damaging Het
Dhx16 T C 17: 35,886,160 L645P probably damaging Het
Dnah14 A G 1: 181,598,403 M171V probably benign Het
Dok7 A T 5: 35,064,522 M60L probably benign Het
Donson A T 16: 91,688,711 M1K probably null Het
Dsp C T 13: 38,192,883 T1548M probably benign Het
Dyrk1a A G 16: 94,692,043 T712A probably damaging Het
Eef2 A G 10: 81,181,282 T708A probably benign Het
Epn3 G A 11: 94,493,780 T289I probably benign Het
Fam171a1 C T 2: 3,226,472 R881* probably null Het
Fam71a G A 1: 191,164,353 T31M probably benign Het
Fat2 T A 11: 55,282,304 R2528W probably damaging Het
Fgfr1 T G 8: 25,573,839 F707C probably damaging Het
Frem2 G C 3: 53,654,753 P778A probably damaging Het
Ganc A G 2: 120,430,599 Y255C probably damaging Het
Ginm1 A T 10: 7,777,850 Y65* probably null Het
Gm11559 T A 11: 99,864,881 C119S unknown Het
Gnai1 T A 5: 18,289,551 H188L Het
H6pd C T 4: 149,996,350 A13T probably benign Het
Hist1h2be T C 13: 23,585,923 K12E probably benign Het
Hoxd12 A T 2: 74,675,246 T54S possibly damaging Het
Hs3st5 T A 10: 36,833,194 L242M probably damaging Het
Il9r C A 11: 32,194,389 V139L possibly damaging Het
Immt A G 6: 71,846,369 D68G probably damaging Het
Itsn2 A G 12: 4,632,985 I304V unknown Het
Lgr4 G A 2: 109,996,629 W159* probably null Het
Lin52 G A 12: 84,457,954 G38S probably damaging Het
Lpgat1 A T 1: 191,719,453 M64L probably benign Het
Lrrc10b G T 19: 10,456,778 R180S possibly damaging Het
Lrrc29 T C 8: 105,312,898 D127G probably damaging Het
Lrrc36 A T 8: 105,449,769 L258F possibly damaging Het
Ltbp4 T A 7: 27,329,755 Q235L unknown Het
Maml2 A G 9: 13,621,607 M706V Het
Mc5r G T 18: 68,339,668 C366F probably damaging Het
Mlip T C 9: 77,164,842 R244G probably benign Het
Muc16 T A 9: 18,585,013 R6658S probably benign Het
Mup4 G T 4: 59,960,046 H73N possibly damaging Het
Nf1 A G 11: 79,564,943 M565V probably benign Het
Nphp1 G A 2: 127,761,217 T382I possibly damaging Het
Nrcam C T 12: 44,564,026 T503I possibly damaging Het
Nwd2 A T 5: 63,800,409 N361Y probably damaging Het
Olfr1045 A G 2: 86,198,573 Y60H probably damaging Het
Olfr1309 A T 2: 111,983,327 L249* probably null Het
Olfr308 A G 7: 86,321,574 I126T probably damaging Het
Olfr461 G T 6: 40,544,895 A28E probably damaging Het
Olfr518 A T 7: 108,880,816 H263Q probably damaging Het
Olfr836 A G 9: 19,121,669 Y235C probably benign Het
Olfr993 A T 2: 85,414,444 V145E probably damaging Het
Orc5 A G 5: 22,523,584 F308L probably benign Het
Padi1 T A 4: 140,832,404 Y54F probably benign Het
Parp1 A G 1: 180,569,100 K23E possibly damaging Het
Pate1 A T 9: 35,685,972 V79D possibly damaging Het
Pcdh18 T C 3: 49,756,860 H2R probably benign Het
Pcnx2 G A 8: 125,887,083 S543F probably damaging Het
Pcp4l1 G A 1: 171,174,465 A42V possibly damaging Het
Pnkp T A 7: 44,859,734 F169L probably damaging Het
Ppp6r3 A T 19: 3,507,325 N254K probably damaging Het
Psd A G 19: 46,324,454 L159P probably benign Het
Ptprf A G 4: 118,231,669 Y646H probably damaging Het
Rab3ip A T 10: 116,937,633 S92T probably benign Het
Rabgef1 A G 5: 130,187,351 probably benign Het
Ralgapa1 C A 12: 55,709,004 W1129L probably damaging Het
Rhpn2 T A 7: 35,385,463 L594Q probably benign Het
Rnf38 C A 4: 44,158,989 probably benign Het
Ryr2 T A 13: 11,738,194 H1747L possibly damaging Het
Sec16a A G 2: 26,439,717 L13P unknown Het
Sppl3 C A 5: 115,082,335 T102K probably damaging Het
Srgap2 A T 1: 131,291,613 Y264* probably null Het
Stxbp2 T C 8: 3,641,151 M465T Het
Sumf2 A G 5: 129,862,710 K305R probably benign Het
Susd2 T A 10: 75,642,565 Y59F probably benign Het
Taco1 T C 11: 106,072,617 V198A probably benign Het
Tas2r136 A T 6: 132,777,906 M86K possibly damaging Het
Tbc1d10c T C 19: 4,184,898 E388G possibly damaging Het
Tmem132c C T 5: 127,564,059 T1098I possibly damaging Het
Trim3 G T 7: 105,617,800 Y457* probably null Het
Ttc38 A G 15: 85,852,861 T316A probably benign Het
Ubqln4 T A 3: 88,555,910 N127K probably benign Het
Wdr91 A T 6: 34,904,626 F262Y probably damaging Het
Zdhhc6 A T 19: 55,302,755 C343S possibly damaging Het
Zfp248 A G 6: 118,430,209 C140R probably damaging Het
Zfp266 T C 9: 20,502,095 T90A probably benign Het
Zfp407 A T 18: 84,559,042 D1315E possibly damaging Het
Zfp644 T C 5: 106,638,277 S135G probably benign Het
Zscan29 A T 2: 121,160,988 I773N probably damaging Het
Zswim5 T A 4: 116,980,834 V787E possibly damaging Het
Other mutations in Dnhd1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00321:Dnhd1 APN 7 105677995 missense probably damaging 1.00
IGL00516:Dnhd1 APN 7 105657211 missense possibly damaging 0.52
IGL00576:Dnhd1 APN 7 105692675 missense probably damaging 1.00
IGL00990:Dnhd1 APN 7 105721688 missense possibly damaging 0.85
IGL01346:Dnhd1 APN 7 105713909 missense probably benign
IGL01714:Dnhd1 APN 7 105720942 missense probably damaging 1.00
IGL01735:Dnhd1 APN 7 105713754 missense probably benign 0.37
IGL01814:Dnhd1 APN 7 105652030 missense probably benign
IGL01999:Dnhd1 APN 7 105721215 missense possibly damaging 0.50
IGL02022:Dnhd1 APN 7 105678309 missense probably damaging 1.00
IGL02131:Dnhd1 APN 7 105720802 missense probably damaging 1.00
IGL02156:Dnhd1 APN 7 105721744 missense probably damaging 1.00
IGL02674:Dnhd1 APN 7 105721481 missense probably benign 0.00
IGL02966:Dnhd1 APN 7 105720741 missense probably benign 0.00
IGL03066:Dnhd1 APN 7 105719882 missense probably damaging 0.99
IGL03298:Dnhd1 APN 7 105714475 missense probably damaging 0.98
IGL03378:Dnhd1 APN 7 105713733 missense possibly damaging 0.87
IGL02802:Dnhd1 UTSW 7 105655723 missense possibly damaging 0.83
R0060:Dnhd1 UTSW 7 105668514 missense probably damaging 0.99
R0129:Dnhd1 UTSW 7 105720924 missense probably benign 0.19
R0238:Dnhd1 UTSW 7 105721531 missense probably benign 0.06
R0238:Dnhd1 UTSW 7 105721531 missense probably benign 0.06
R0239:Dnhd1 UTSW 7 105721531 missense probably benign 0.06
R0239:Dnhd1 UTSW 7 105721531 missense probably benign 0.06
R0384:Dnhd1 UTSW 7 105720114 missense possibly damaging 0.56
R0453:Dnhd1 UTSW 7 105674444 missense probably benign 0.00
R0540:Dnhd1 UTSW 7 105720788 missense probably benign 0.04
R0554:Dnhd1 UTSW 7 105694395 missense probably benign 0.10
R0576:Dnhd1 UTSW 7 105714045 missense probably damaging 1.00
R0607:Dnhd1 UTSW 7 105720788 missense probably benign 0.04
R0631:Dnhd1 UTSW 7 105651624 missense probably benign 0.17
R0639:Dnhd1 UTSW 7 105696464 missense possibly damaging 0.95
R0668:Dnhd1 UTSW 7 105695751 missense probably benign
R0669:Dnhd1 UTSW 7 105693704 missense probably benign 0.01
R0670:Dnhd1 UTSW 7 105696464 missense possibly damaging 0.95
R0699:Dnhd1 UTSW 7 105651906 missense probably damaging 0.98
R1019:Dnhd1 UTSW 7 105709171 missense probably damaging 1.00
R1144:Dnhd1 UTSW 7 105713031 missense probably damaging 1.00
R1226:Dnhd1 UTSW 7 105696899 missense probably damaging 1.00
R1257:Dnhd1 UTSW 7 105694153 missense probably damaging 1.00
R1391:Dnhd1 UTSW 7 105720124 missense probably damaging 1.00
R1453:Dnhd1 UTSW 7 105721273 critical splice donor site probably null
R1501:Dnhd1 UTSW 7 105668463 missense probably benign 0.00
R1503:Dnhd1 UTSW 7 105693660 missense possibly damaging 0.67
R1515:Dnhd1 UTSW 7 105704148 missense probably benign 0.11
R1615:Dnhd1 UTSW 7 105703206 missense probably benign 0.00
R1615:Dnhd1 UTSW 7 105713706 missense possibly damaging 0.74
R1656:Dnhd1 UTSW 7 105714281 missense probably damaging 1.00
R1720:Dnhd1 UTSW 7 105693828 missense probably benign
R1723:Dnhd1 UTSW 7 105714920 missense possibly damaging 0.60
R1766:Dnhd1 UTSW 7 105693972 missense possibly damaging 0.50
R1799:Dnhd1 UTSW 7 105655767 missense probably benign 0.31
R1860:Dnhd1 UTSW 7 105704205 missense probably benign
R1920:Dnhd1 UTSW 7 105713407 missense probably benign 0.00
R1925:Dnhd1 UTSW 7 105652252 missense probably damaging 1.00
R1925:Dnhd1 UTSW 7 105673854 missense probably damaging 0.96
R1934:Dnhd1 UTSW 7 105708582 missense probably benign 0.05
R1935:Dnhd1 UTSW 7 105673976 missense probably benign 0.09
R1936:Dnhd1 UTSW 7 105673976 missense probably benign 0.09
R2035:Dnhd1 UTSW 7 105704921 missense probably damaging 0.99
R2125:Dnhd1 UTSW 7 105677971 missense probably benign 0.35
R2127:Dnhd1 UTSW 7 105693721 missense possibly damaging 0.56
R2254:Dnhd1 UTSW 7 105703772 missense probably damaging 1.00
R2301:Dnhd1 UTSW 7 105705399 missense probably damaging 1.00
R2316:Dnhd1 UTSW 7 105674421 missense probably damaging 1.00
R2324:Dnhd1 UTSW 7 105710090 missense probably damaging 1.00
R2337:Dnhd1 UTSW 7 105703467 missense probably benign 0.07
R2381:Dnhd1 UTSW 7 105693664 missense probably benign 0.42
R2394:Dnhd1 UTSW 7 105720231 missense probably benign 0.19
R2862:Dnhd1 UTSW 7 105712559 missense probably benign 0.01
R3038:Dnhd1 UTSW 7 105720229 missense probably damaging 0.99
R3114:Dnhd1 UTSW 7 105696565 critical splice donor site probably null
R3404:Dnhd1 UTSW 7 105694761 nonsense probably null
R3405:Dnhd1 UTSW 7 105694761 nonsense probably null
R3439:Dnhd1 UTSW 7 105694785 missense probably damaging 1.00
R3959:Dnhd1 UTSW 7 105713122 missense probably benign 0.21
R4014:Dnhd1 UTSW 7 105714838 missense probably damaging 0.99
R4084:Dnhd1 UTSW 7 105709588 missense probably damaging 1.00
R4181:Dnhd1 UTSW 7 105693954 missense probably damaging 1.00
R4255:Dnhd1 UTSW 7 105712998 missense probably damaging 1.00
R4302:Dnhd1 UTSW 7 105693954 missense probably damaging 1.00
R4440:Dnhd1 UTSW 7 105696728 nonsense probably null
R4565:Dnhd1 UTSW 7 105651956 missense possibly damaging 0.92
R4569:Dnhd1 UTSW 7 105657166 splice site probably null
R4584:Dnhd1 UTSW 7 105678049 missense probably damaging 1.00
R4586:Dnhd1 UTSW 7 105678049 missense probably damaging 1.00
R4590:Dnhd1 UTSW 7 105714030 missense probably damaging 1.00
R4593:Dnhd1 UTSW 7 105715446 missense probably benign 0.02
R4600:Dnhd1 UTSW 7 105703644 missense probably damaging 1.00
R4705:Dnhd1 UTSW 7 105655741 missense probably damaging 1.00
R4731:Dnhd1 UTSW 7 105673849 missense probably benign 0.00
R4732:Dnhd1 UTSW 7 105673849 missense probably benign 0.00
R4733:Dnhd1 UTSW 7 105673849 missense probably benign 0.00
R4786:Dnhd1 UTSW 7 105674444 missense probably benign 0.00
R4791:Dnhd1 UTSW 7 105721117 missense probably damaging 1.00
R4811:Dnhd1 UTSW 7 105714281 missense probably damaging 0.99
R4822:Dnhd1 UTSW 7 105703964 missense probably benign 0.00
R4886:Dnhd1 UTSW 7 105714808 missense probably benign 0.00
R4890:Dnhd1 UTSW 7 105656957 missense possibly damaging 0.47
R4973:Dnhd1 UTSW 7 105713633 missense probably benign 0.24
R5007:Dnhd1 UTSW 7 105713076 missense probably damaging 1.00
R5048:Dnhd1 UTSW 7 105693697 missense probably benign 0.01
R5151:Dnhd1 UTSW 7 105713440 missense probably benign 0.22
R5179:Dnhd1 UTSW 7 105714552 missense probably damaging 1.00
R5182:Dnhd1 UTSW 7 105703209 missense probably damaging 1.00
R5183:Dnhd1 UTSW 7 105703209 missense probably damaging 1.00
R5185:Dnhd1 UTSW 7 105703209 missense probably damaging 1.00
R5209:Dnhd1 UTSW 7 105696460 missense probably benign 0.00
R5225:Dnhd1 UTSW 7 105703923 missense possibly damaging 0.73
R5250:Dnhd1 UTSW 7 105685761 missense probably damaging 1.00
R5257:Dnhd1 UTSW 7 105674037 missense probably benign
R5258:Dnhd1 UTSW 7 105674037 missense probably benign
R5273:Dnhd1 UTSW 7 105714482 missense probably damaging 0.99
R5288:Dnhd1 UTSW 7 105714437 missense possibly damaging 0.94
R5396:Dnhd1 UTSW 7 105713684 missense probably benign 0.00
R5453:Dnhd1 UTSW 7 105710123 missense probably damaging 1.00
R5511:Dnhd1 UTSW 7 105714156 missense probably damaging 1.00
R5518:Dnhd1 UTSW 7 105703209 missense probably damaging 1.00
R5523:Dnhd1 UTSW 7 105703209 missense probably damaging 1.00
R5528:Dnhd1 UTSW 7 105703209 missense probably damaging 1.00
R5529:Dnhd1 UTSW 7 105703209 missense probably damaging 1.00
R5561:Dnhd1 UTSW 7 105714821 missense probably damaging 0.99
R5681:Dnhd1 UTSW 7 105703209 missense probably damaging 1.00
R5682:Dnhd1 UTSW 7 105703209 missense probably damaging 1.00
R5683:Dnhd1 UTSW 7 105703209 missense probably damaging 1.00
R5684:Dnhd1 UTSW 7 105703209 missense probably damaging 1.00
R5686:Dnhd1 UTSW 7 105703209 missense probably damaging 1.00
R5697:Dnhd1 UTSW 7 105674188 missense probably damaging 1.00
R5789:Dnhd1 UTSW 7 105705010 missense possibly damaging 0.50
R5790:Dnhd1 UTSW 7 105655774 missense probably damaging 1.00
R5814:Dnhd1 UTSW 7 105719895 missense possibly damaging 0.69
R5828:Dnhd1 UTSW 7 105720181 missense probably benign 0.00
R5852:Dnhd1 UTSW 7 105695748 missense probably damaging 1.00
R5883:Dnhd1 UTSW 7 105720504 missense probably damaging 0.98
R6115:Dnhd1 UTSW 7 105713987 missense probably benign 0.00
R6119:Dnhd1 UTSW 7 105709440 missense probably benign 0.18
R6212:Dnhd1 UTSW 7 105704048 missense probably damaging 1.00
R6243:Dnhd1 UTSW 7 105652009 missense probably damaging 1.00
R6265:Dnhd1 UTSW 7 105693370 missense probably benign 0.07
R6332:Dnhd1 UTSW 7 105694066 missense probably benign 0.02
R6344:Dnhd1 UTSW 7 105694610 missense probably benign 0.38
R6477:Dnhd1 UTSW 7 105677886 missense probably benign 0.05
R6642:Dnhd1 UTSW 7 105703799 missense probably benign
R6663:Dnhd1 UTSW 7 105685692 intron probably null
R6730:Dnhd1 UTSW 7 105703875 missense probably benign 0.00
R6748:Dnhd1 UTSW 7 105720637 missense probably benign 0.03
R6833:Dnhd1 UTSW 7 105703373 missense probably benign 0.01
R6850:Dnhd1 UTSW 7 105719930 missense possibly damaging 0.68
R6853:Dnhd1 UTSW 7 105703728 missense probably benign
R6860:Dnhd1 UTSW 7 105678266 missense probably benign
R6898:Dnhd1 UTSW 7 105687377 missense probably damaging 0.99
R6927:Dnhd1 UTSW 7 105715563 missense probably damaging 1.00
R6952:Dnhd1 UTSW 7 105713688 missense probably damaging 1.00
R6987:Dnhd1 UTSW 7 105704585 missense probably damaging 0.98
R6988:Dnhd1 UTSW 7 105714210 missense probably damaging 1.00
R7022:Dnhd1 UTSW 7 105720798 missense probably benign 0.36
R7053:Dnhd1 UTSW 7 105694954 missense probably damaging 1.00
R7085:Dnhd1 UTSW 7 105715261 missense probably benign 0.26
R7086:Dnhd1 UTSW 7 105708532 missense probably benign 0.03
R7112:Dnhd1 UTSW 7 105713985 missense probably damaging 1.00
R7140:Dnhd1 UTSW 7 105693766 missense probably benign 0.00
R7151:Dnhd1 UTSW 7 105710027 missense probably benign 0.03
R7178:Dnhd1 UTSW 7 105694993 missense probably damaging 0.98
R7345:Dnhd1 UTSW 7 105703967 missense probably benign 0.17
R7349:Dnhd1 UTSW 7 105710123 missense probably damaging 1.00
R7397:Dnhd1 UTSW 7 105705297 missense possibly damaging 0.87
R7520:Dnhd1 UTSW 7 105696048 missense probably benign 0.07
R7536:Dnhd1 UTSW 7 105709561 missense probably damaging 1.00
R7539:Dnhd1 UTSW 7 105720912 missense probably damaging 1.00
R7541:Dnhd1 UTSW 7 105678309 missense probably damaging 1.00
R7619:Dnhd1 UTSW 7 105674268 missense probably benign 0.01
R7676:Dnhd1 UTSW 7 105684087 missense probably benign 0.09
R7689:Dnhd1 UTSW 7 105713963 missense probably benign 0.07
R7712:Dnhd1 UTSW 7 105651624 missense probably benign 0.17
R7729:Dnhd1 UTSW 7 105705265 missense probably damaging 1.00
Z1088:Dnhd1 UTSW 7 105712727 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- CTTCAGGCTTTGCTAACCAACAAC -3'
(R):5'- CCGACAGGTGAAATATGCGC -3'

Sequencing Primer
(F):5'- AACCGTATTCGCTCAGGC -3'
(R):5'- CAGGTGAAATATGCGCTCTGG -3'
Posted On2019-09-13