Incidental Mutation 'R7326:Fat2'
ID568933
Institutional Source Beutler Lab
Gene Symbol Fat2
Ensembl Gene ENSMUSG00000055333
Gene NameFAT atypical cadherin 2
SynonymsmKIAA0811, LOC245827, Fath2, EMI2
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7326 (G1)
Quality Score225.009
Status Not validated
Chromosome11
Chromosomal Location55250609-55336564 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 55282304 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Tryptophan at position 2528 (R2528W)
Ref Sequence ENSEMBL: ENSMUSP00000067556 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000068853] [ENSMUST00000108864]
Predicted Effect probably damaging
Transcript: ENSMUST00000068853
AA Change: R2528W

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000067556
Gene: ENSMUSG00000055333
AA Change: R2528W

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
CA 55 146 3.65e-4 SMART
CA 170 254 3.99e-10 SMART
low complexity region 337 348 N/A INTRINSIC
CA 384 456 5.11e-8 SMART
CA 480 562 2.71e-21 SMART
CA 586 664 1.12e-2 SMART
CA 737 818 1.69e-22 SMART
CA 842 923 9.59e-22 SMART
CA 947 1028 7.39e-14 SMART
CA 1054 1135 3.74e-24 SMART
CA 1159 1240 1.84e-23 SMART
CA 1266 1342 8.9e-8 SMART
CA 1368 1446 7.4e-5 SMART
CA 1470 1553 1.98e-14 SMART
CA 1577 1658 6.84e-18 SMART
CA 1682 1756 2.76e-13 SMART
CA 1787 1870 1.49e-18 SMART
CA 1894 1966 1.11e-1 SMART
CA 1990 2068 2.4e-13 SMART
CA 2092 2171 3.42e-18 SMART
CA 2190 2270 1.9e-16 SMART
CA 2294 2377 1.49e-27 SMART
CA 2401 2479 8.31e-8 SMART
CA 2503 2583 6.48e-19 SMART
CA 2607 2690 1.53e-6 SMART
CA 2714 2797 3e-14 SMART
CA 2821 2906 5.85e-26 SMART
CA 2930 3011 4.58e-19 SMART
CA 3035 3113 2.1e-27 SMART
CA 3137 3218 9.67e-18 SMART
CA 3243 3321 1.92e-12 SMART
CA 3345 3426 4.04e-29 SMART
CA 3450 3531 1.79e-12 SMART
CA 3555 3629 9.3e-2 SMART
LamG 3794 3923 1.77e-28 SMART
EGF 3952 3986 6.5e-5 SMART
EGF 3991 4024 1.6e-4 SMART
transmembrane domain 4051 4073 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000108864
AA Change: R2528W

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000104492
Gene: ENSMUSG00000055333
AA Change: R2528W

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
CA 55 146 3.65e-4 SMART
CA 170 254 3.99e-10 SMART
low complexity region 337 348 N/A INTRINSIC
CA 384 456 5.11e-8 SMART
CA 480 562 2.71e-21 SMART
CA 586 664 1.12e-2 SMART
CA 737 818 1.69e-22 SMART
CA 842 923 9.59e-22 SMART
CA 947 1028 7.39e-14 SMART
CA 1054 1135 3.74e-24 SMART
CA 1159 1240 1.84e-23 SMART
CA 1266 1342 8.9e-8 SMART
CA 1368 1446 7.4e-5 SMART
CA 1470 1553 1.98e-14 SMART
CA 1577 1658 6.84e-18 SMART
CA 1682 1756 2.76e-13 SMART
CA 1787 1870 1.49e-18 SMART
CA 1894 1966 1.11e-1 SMART
CA 1990 2068 2.4e-13 SMART
CA 2092 2171 3.42e-18 SMART
CA 2190 2270 1.9e-16 SMART
CA 2294 2377 1.49e-27 SMART
CA 2401 2479 8.31e-8 SMART
CA 2503 2583 6.48e-19 SMART
CA 2607 2690 1.53e-6 SMART
CA 2714 2797 3e-14 SMART
CA 2821 2906 5.85e-26 SMART
CA 2930 3011 4.58e-19 SMART
CA 3035 3113 2.1e-27 SMART
CA 3137 3218 9.67e-18 SMART
CA 3243 3321 1.92e-12 SMART
CA 3345 3426 4.04e-29 SMART
CA 3450 3531 1.79e-12 SMART
CA 3555 3629 9.3e-2 SMART
LamG 3794 3923 1.77e-28 SMART
EGF 3952 3986 6.5e-5 SMART
EGF 3991 4024 1.6e-4 SMART
transmembrane domain 4051 4073 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is the second identified human homolog of the Drosophila fat gene, which encodes a tumor suppressor essential for controlling cell proliferation during Drosophila development. The gene product is a member of the cadherin superfamily, a group of integral membrane proteins characterized by the presence of cadherin-type repeats. In addition to containing 34 tandem cadherin-type repeats, the gene product has two epidermal growth factor (EGF)-like repeats and one laminin G domain. This protein most likely functions as a cell adhesion molecule, controlling cell proliferation and playing an important role in cerebellum development. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele are healthy, fertile and overtly normal, with no apparent defects in the development of red blood cells or platelets. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 112 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
6430531B16Rik A T 7: 139,978,545 probably null Het
Abcb4 T C 5: 8,934,226 V652A probably benign Het
Acvrl1 G T 15: 101,141,072 V417L probably damaging Het
Add1 A G 5: 34,619,371 R479G probably benign Het
Adgb A T 10: 10,400,574 L350Q possibly damaging Het
Adgrl2 A T 3: 148,846,870 S666T probably benign Het
Akap9 T A 5: 4,045,930 D2268E possibly damaging Het
Amigo3 C A 9: 108,054,066 H229Q probably benign Het
Ano6 G C 15: 95,864,244 Q31H possibly damaging Het
Ap4m1 G A 5: 138,175,019 D180N probably damaging Het
Apc2 A T 10: 80,311,740 D876V probably damaging Het
Apcdd1 T A 18: 62,952,188 Y485* probably null Het
Aqp1 G T 6: 55,336,851 D121Y probably benign Het
Bicd2 C A 13: 49,369,609 R141S probably benign Het
Brpf3 C A 17: 28,806,293 H113Q probably benign Het
Cacng2 A T 15: 78,013,320 Y96* probably null Het
Catsperg1 G T 7: 29,210,759 N52K possibly damaging Het
Celsr2 A C 3: 108,394,995 F2606V possibly damaging Het
Cerkl A T 2: 79,332,605 N516K probably benign Het
Ciita G A 16: 10,512,288 R812H probably damaging Het
Cldn3 T A 5: 134,986,983 L180Q probably damaging Het
Cnot6l T C 5: 96,077,299 I512V probably benign Het
Col5a2 A T 1: 45,442,867 D32E unknown Het
Coro7 A G 16: 4,632,048 V616A probably damaging Het
Cyp4f18 T C 8: 71,988,654 D494G probably benign Het
Ddx39 T A 8: 83,722,471 V296E probably benign Het
Dgkg A T 16: 22,548,690 H593Q probably damaging Het
Dhx16 T C 17: 35,886,160 L645P probably damaging Het
Dnah14 A G 1: 181,598,403 M171V probably benign Het
Dnhd1 G A 7: 105,720,930 V4521I probably damaging Het
Dok7 A T 5: 35,064,522 M60L probably benign Het
Donson A T 16: 91,688,711 M1K probably null Het
Dsp C T 13: 38,192,883 T1548M probably benign Het
Dyrk1a A G 16: 94,692,043 T712A probably damaging Het
Eef2 A G 10: 81,181,282 T708A probably benign Het
Epn3 G A 11: 94,493,780 T289I probably benign Het
Fam171a1 C T 2: 3,226,472 R881* probably null Het
Fam71a G A 1: 191,164,353 T31M probably benign Het
Fgfr1 T G 8: 25,573,839 F707C probably damaging Het
Frem2 G C 3: 53,654,753 P778A probably damaging Het
Ganc A G 2: 120,430,599 Y255C probably damaging Het
Ginm1 A T 10: 7,777,850 Y65* probably null Het
Gm11559 T A 11: 99,864,881 C119S unknown Het
Gnai1 T A 5: 18,289,551 H188L Het
H6pd C T 4: 149,996,350 A13T probably benign Het
Hist1h2be T C 13: 23,585,923 K12E probably benign Het
Hoxd12 A T 2: 74,675,246 T54S possibly damaging Het
Hs3st5 T A 10: 36,833,194 L242M probably damaging Het
Il9r C A 11: 32,194,389 V139L possibly damaging Het
Immt A G 6: 71,846,369 D68G probably damaging Het
Itsn2 A G 12: 4,632,985 I304V unknown Het
Lgr4 G A 2: 109,996,629 W159* probably null Het
Lin52 G A 12: 84,457,954 G38S probably damaging Het
Lpgat1 A T 1: 191,719,453 M64L probably benign Het
Lrrc10b G T 19: 10,456,778 R180S possibly damaging Het
Lrrc29 T C 8: 105,312,898 D127G probably damaging Het
Lrrc36 A T 8: 105,449,769 L258F possibly damaging Het
Ltbp4 T A 7: 27,329,755 Q235L unknown Het
Maml2 A G 9: 13,621,607 M706V Het
Mc5r G T 18: 68,339,668 C366F probably damaging Het
Mlip T C 9: 77,164,842 R244G probably benign Het
Muc16 T A 9: 18,585,013 R6658S probably benign Het
Mup4 G T 4: 59,960,046 H73N possibly damaging Het
Nf1 A G 11: 79,564,943 M565V probably benign Het
Nphp1 G A 2: 127,761,217 T382I possibly damaging Het
Nrcam C T 12: 44,564,026 T503I possibly damaging Het
Nwd2 A T 5: 63,800,409 N361Y probably damaging Het
Olfr1045 A G 2: 86,198,573 Y60H probably damaging Het
Olfr1309 A T 2: 111,983,327 L249* probably null Het
Olfr308 A G 7: 86,321,574 I126T probably damaging Het
Olfr461 G T 6: 40,544,895 A28E probably damaging Het
Olfr518 A T 7: 108,880,816 H263Q probably damaging Het
Olfr836 A G 9: 19,121,669 Y235C probably benign Het
Olfr993 A T 2: 85,414,444 V145E probably damaging Het
Orc5 A G 5: 22,523,584 F308L probably benign Het
Padi1 T A 4: 140,832,404 Y54F probably benign Het
Parp1 A G 1: 180,569,100 K23E possibly damaging Het
Pate1 A T 9: 35,685,972 V79D possibly damaging Het
Pcdh18 T C 3: 49,756,860 H2R probably benign Het
Pcnx2 G A 8: 125,887,083 S543F probably damaging Het
Pcp4l1 G A 1: 171,174,465 A42V possibly damaging Het
Pnkp T A 7: 44,859,734 F169L probably damaging Het
Ppp6r3 A T 19: 3,507,325 N254K probably damaging Het
Psd A G 19: 46,324,454 L159P probably benign Het
Ptprf A G 4: 118,231,669 Y646H probably damaging Het
Rab3ip A T 10: 116,937,633 S92T probably benign Het
Rabgef1 A G 5: 130,187,351 probably benign Het
Ralgapa1 C A 12: 55,709,004 W1129L probably damaging Het
Rhpn2 T A 7: 35,385,463 L594Q probably benign Het
Rnf38 C A 4: 44,158,989 probably benign Het
Ryr2 T A 13: 11,738,194 H1747L possibly damaging Het
Sec16a A G 2: 26,439,717 L13P unknown Het
Sppl3 C A 5: 115,082,335 T102K probably damaging Het
Srgap2 A T 1: 131,291,613 Y264* probably null Het
Stxbp2 T C 8: 3,641,151 M465T Het
Sumf2 A G 5: 129,862,710 K305R probably benign Het
Susd2 T A 10: 75,642,565 Y59F probably benign Het
Taco1 T C 11: 106,072,617 V198A probably benign Het
Tas2r136 A T 6: 132,777,906 M86K possibly damaging Het
Tbc1d10c T C 19: 4,184,898 E388G possibly damaging Het
Tmem132c C T 5: 127,564,059 T1098I possibly damaging Het
Trim3 G T 7: 105,617,800 Y457* probably null Het
Ttc38 A G 15: 85,852,861 T316A probably benign Het
Ubqln4 T A 3: 88,555,910 N127K probably benign Het
Wdr91 A T 6: 34,904,626 F262Y probably damaging Het
Zdhhc6 A T 19: 55,302,755 C343S possibly damaging Het
Zfp248 A G 6: 118,430,209 C140R probably damaging Het
Zfp266 T C 9: 20,502,095 T90A probably benign Het
Zfp407 A T 18: 84,559,042 D1315E possibly damaging Het
Zfp644 T C 5: 106,638,277 S135G probably benign Het
Zscan29 A T 2: 121,160,988 I773N probably damaging Het
Zswim5 T A 4: 116,980,834 V787E possibly damaging Het
Other mutations in Fat2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00720:Fat2 APN 11 55311244 missense probably benign
IGL00897:Fat2 APN 11 55289252 missense probably damaging 0.99
IGL01161:Fat2 APN 11 55284191 missense probably benign
IGL01306:Fat2 APN 11 55310872 missense probably benign 0.28
IGL01393:Fat2 APN 11 55269309 missense probably benign 0.00
IGL01529:Fat2 APN 11 55282156 missense probably damaging 1.00
IGL01530:Fat2 APN 11 55283387 missense probably benign 0.42
IGL01555:Fat2 APN 11 55278930 missense probably damaging 0.99
IGL01758:Fat2 APN 11 55296209 missense probably damaging 1.00
IGL01768:Fat2 APN 11 55262568 missense probably damaging 1.00
IGL01939:Fat2 APN 11 55283980 missense probably benign 0.01
IGL01941:Fat2 APN 11 55312005 missense probably benign 0.01
IGL01967:Fat2 APN 11 55311823 missense probably damaging 1.00
IGL01978:Fat2 APN 11 55270146 missense probably benign 0.34
IGL01998:Fat2 APN 11 55296195 missense probably benign 0.00
IGL02001:Fat2 APN 11 55312245 start codon destroyed probably null 0.89
IGL02004:Fat2 APN 11 55282840 missense probably damaging 1.00
IGL02103:Fat2 APN 11 55289296 missense probably damaging 0.96
IGL02131:Fat2 APN 11 55309042 missense probably damaging 1.00
IGL02155:Fat2 APN 11 55262419 missense probably benign 0.00
IGL02223:Fat2 APN 11 55273129 missense probably benign 0.01
IGL02231:Fat2 APN 11 55281092 missense probably damaging 0.98
IGL02312:Fat2 APN 11 55270259 missense probably damaging 1.00
IGL02476:Fat2 APN 11 55311124 missense probably damaging 1.00
IGL02539:Fat2 APN 11 55281793 missense probably damaging 1.00
IGL02553:Fat2 APN 11 55311283 missense probably damaging 1.00
IGL02645:Fat2 APN 11 55282828 missense probably damaging 1.00
IGL02664:Fat2 APN 11 55311096 missense probably damaging 1.00
IGL02708:Fat2 APN 11 55282385 missense probably damaging 0.99
IGL02883:Fat2 APN 11 55256618 missense probably benign 0.16
IGL02894:Fat2 APN 11 55256653 missense probably damaging 1.00
IGL02975:Fat2 APN 11 55270194 missense probably benign 0.00
IGL03085:Fat2 APN 11 55283246 missense probably benign 0.09
IGL03106:Fat2 APN 11 55311901 missense probably benign 0.45
IGL03132:Fat2 APN 11 55253920 missense probably benign 0.25
IGL03133:Fat2 APN 11 55286043 missense probably benign 0.01
IGL03194:Fat2 APN 11 55310995 missense probably benign 0.02
IGL03266:Fat2 APN 11 55284029 missense possibly damaging 0.62
IGL03290:Fat2 APN 11 55256219 missense probably benign 0.33
IGL03291:Fat2 APN 11 55262595 missense probably benign
IGL03325:Fat2 APN 11 55282342 missense probably damaging 1.00
IGL03345:Fat2 APN 11 55282361 missense probably damaging 1.00
IGL03371:Fat2 APN 11 55311164 missense probably benign 0.10
ANU23:Fat2 UTSW 11 55310872 missense probably benign 0.28
BB001:Fat2 UTSW 11 55262787 missense probably benign 0.03
BB011:Fat2 UTSW 11 55262787 missense probably benign 0.03
P0040:Fat2 UTSW 11 55282213 missense possibly damaging 0.89
PIT4504001:Fat2 UTSW 11 55256110 missense possibly damaging 0.68
R0008:Fat2 UTSW 11 55311249 missense probably damaging 1.00
R0008:Fat2 UTSW 11 55311249 missense probably damaging 1.00
R0012:Fat2 UTSW 11 55262871 missense probably benign 0.16
R0012:Fat2 UTSW 11 55262871 missense probably benign 0.16
R0048:Fat2 UTSW 11 55310039 missense probably benign 0.00
R0048:Fat2 UTSW 11 55310039 missense probably benign 0.00
R0098:Fat2 UTSW 11 55298605 missense probably damaging 0.98
R0124:Fat2 UTSW 11 55283678 missense probably damaging 0.98
R0127:Fat2 UTSW 11 55289286 missense probably benign 0.01
R0130:Fat2 UTSW 11 55252118 missense probably benign 0.26
R0131:Fat2 UTSW 11 55273211 missense probably benign
R0158:Fat2 UTSW 11 55296185 missense probably benign 0.00
R0184:Fat2 UTSW 11 55296288 missense probably damaging 1.00
R0367:Fat2 UTSW 11 55292093 splice site probably benign
R0384:Fat2 UTSW 11 55269465 missense possibly damaging 0.81
R0390:Fat2 UTSW 11 55310777 missense probably damaging 0.99
R0403:Fat2 UTSW 11 55270349 missense probably benign 0.42
R0416:Fat2 UTSW 11 55284134 missense possibly damaging 0.94
R0437:Fat2 UTSW 11 55282799 missense probably benign 0.02
R0463:Fat2 UTSW 11 55262829 missense probably damaging 1.00
R0497:Fat2 UTSW 11 55283402 missense probably benign 0.03
R0617:Fat2 UTSW 11 55311843 missense possibly damaging 0.60
R0622:Fat2 UTSW 11 55283128 missense probably damaging 1.00
R0675:Fat2 UTSW 11 55309209 missense probably damaging 0.97
R0811:Fat2 UTSW 11 55253633 missense possibly damaging 0.75
R0812:Fat2 UTSW 11 55253633 missense possibly damaging 0.75
R0869:Fat2 UTSW 11 55311775 missense probably benign 0.08
R0870:Fat2 UTSW 11 55311775 missense probably benign 0.08
R0899:Fat2 UTSW 11 55256225 missense probably damaging 1.00
R1278:Fat2 UTSW 11 55268179 missense probably damaging 1.00
R1383:Fat2 UTSW 11 55310773 missense probably benign
R1428:Fat2 UTSW 11 55296087 missense probably damaging 1.00
R1438:Fat2 UTSW 11 55287811 missense probably damaging 1.00
R1495:Fat2 UTSW 11 55262673 missense probably benign
R1506:Fat2 UTSW 11 55284264 missense probably benign
R1547:Fat2 UTSW 11 55252255 missense probably benign 0.01
R1554:Fat2 UTSW 11 55253664 missense probably benign 0.01
R1562:Fat2 UTSW 11 55309974 missense probably damaging 1.00
R1588:Fat2 UTSW 11 55283404 missense probably damaging 1.00
R1592:Fat2 UTSW 11 55291870 splice site probably null
R1601:Fat2 UTSW 11 55282010 missense probably benign 0.01
R1610:Fat2 UTSW 11 55278924 missense probably damaging 1.00
R1634:Fat2 UTSW 11 55267684 missense probably damaging 1.00
R1634:Fat2 UTSW 11 55284719 missense probably benign
R1644:Fat2 UTSW 11 55287783 missense possibly damaging 0.91
R1644:Fat2 UTSW 11 55296181 missense possibly damaging 0.94
R1691:Fat2 UTSW 11 55311852 missense probably damaging 0.99
R1734:Fat2 UTSW 11 55281371 missense probably benign 0.00
R1748:Fat2 UTSW 11 55256647 missense probably damaging 0.97
R1771:Fat2 UTSW 11 55310865 missense probably benign 0.01
R1800:Fat2 UTSW 11 55283892 missense probably damaging 1.00
R1807:Fat2 UTSW 11 55289259 missense probably damaging 1.00
R1823:Fat2 UTSW 11 55256780 missense probably benign 0.29
R1848:Fat2 UTSW 11 55311558 missense probably damaging 1.00
R1866:Fat2 UTSW 11 55292014 missense probably benign 0.00
R1899:Fat2 UTSW 11 55262178 missense probably benign
R1954:Fat2 UTSW 11 55311084 missense probably benign 0.06
R2010:Fat2 UTSW 11 55253827 missense probably damaging 0.99
R2011:Fat2 UTSW 11 55282757 missense probably damaging 1.00
R2057:Fat2 UTSW 11 55281860 missense possibly damaging 0.60
R2081:Fat2 UTSW 11 55309677 missense possibly damaging 0.94
R2106:Fat2 UTSW 11 55256564 missense probably benign 0.00
R2165:Fat2 UTSW 11 55303716 missense probably benign 0.00
R2176:Fat2 UTSW 11 55267575 critical splice donor site probably null
R2284:Fat2 UTSW 11 55282360 missense probably damaging 1.00
R2338:Fat2 UTSW 11 55311901 missense possibly damaging 0.93
R2340:Fat2 UTSW 11 55270096 missense possibly damaging 0.90
R2427:Fat2 UTSW 11 55310812 missense probably benign 0.15
R2444:Fat2 UTSW 11 55281973 missense probably damaging 1.00
R2858:Fat2 UTSW 11 55283773 missense possibly damaging 0.94
R2882:Fat2 UTSW 11 55311305 missense probably damaging 0.96
R3029:Fat2 UTSW 11 55284709 missense probably damaging 1.00
R3085:Fat2 UTSW 11 55252171 missense possibly damaging 0.79
R3121:Fat2 UTSW 11 55311796 missense probably damaging 1.00
R3418:Fat2 UTSW 11 55278998 missense probably benign 0.01
R3500:Fat2 UTSW 11 55260516 missense probably damaging 0.99
R3607:Fat2 UTSW 11 55281685 missense probably damaging 1.00
R3611:Fat2 UTSW 11 55312069 missense probably benign
R3620:Fat2 UTSW 11 55256695 missense probably damaging 0.97
R3688:Fat2 UTSW 11 55281101 missense probably damaging 0.99
R3704:Fat2 UTSW 11 55309650 missense probably damaging 1.00
R3784:Fat2 UTSW 11 55256186 missense probably benign
R3889:Fat2 UTSW 11 55281763 missense probably damaging 1.00
R3951:Fat2 UTSW 11 55296382 missense probably benign 0.00
R4211:Fat2 UTSW 11 55283984 missense probably damaging 1.00
R4249:Fat2 UTSW 11 55284301 missense probably damaging 0.98
R4406:Fat2 UTSW 11 55262268 missense probably benign 0.00
R4433:Fat2 UTSW 11 55309640 missense possibly damaging 0.91
R4436:Fat2 UTSW 11 55296198 missense probably damaging 1.00
R4498:Fat2 UTSW 11 55270097 missense possibly damaging 0.90
R4560:Fat2 UTSW 11 55265951 missense possibly damaging 0.89
R4594:Fat2 UTSW 11 55284752 missense possibly damaging 0.78
R4663:Fat2 UTSW 11 55296213 nonsense probably null
R4669:Fat2 UTSW 11 55311615 missense probably benign 0.01
R4696:Fat2 UTSW 11 55285015 missense probably benign 0.00
R4734:Fat2 UTSW 11 55311468 missense probably benign 0.01
R4749:Fat2 UTSW 11 55311468 missense probably benign 0.01
R4765:Fat2 UTSW 11 55281187 missense probably damaging 1.00
R4803:Fat2 UTSW 11 55285060 missense probably benign 0.03
R4805:Fat2 UTSW 11 55283979 missense probably benign 0.01
R4822:Fat2 UTSW 11 55311318 missense probably benign 0.02
R4840:Fat2 UTSW 11 55279018 missense probably benign 0.21
R4849:Fat2 UTSW 11 55310637 missense probably damaging 1.00
R4943:Fat2 UTSW 11 55279033 missense probably benign 0.00
R4993:Fat2 UTSW 11 55283092 missense probably damaging 0.99
R5097:Fat2 UTSW 11 55310704 missense probably damaging 1.00
R5104:Fat2 UTSW 11 55278988 missense possibly damaging 0.93
R5115:Fat2 UTSW 11 55296333 missense probably damaging 1.00
R5213:Fat2 UTSW 11 55253832 missense probably benign 0.00
R5254:Fat2 UTSW 11 55281175 missense probably damaging 1.00
R5269:Fat2 UTSW 11 55287878 missense probably benign 0.00
R5288:Fat2 UTSW 11 55267656 missense probably benign 0.00
R5355:Fat2 UTSW 11 55282166 missense probably damaging 1.00
R5375:Fat2 UTSW 11 55262820 missense probably benign 0.00
R5379:Fat2 UTSW 11 55303941 missense probably damaging 0.99
R5411:Fat2 UTSW 11 55252226 missense probably benign 0.23
R5416:Fat2 UTSW 11 55303688 missense possibly damaging 0.77
R5480:Fat2 UTSW 11 55310086 missense probably damaging 0.99
R5486:Fat2 UTSW 11 55253681 missense probably benign 0.00
R5526:Fat2 UTSW 11 55269361 missense possibly damaging 0.90
R5532:Fat2 UTSW 11 55262337 missense probably damaging 1.00
R5583:Fat2 UTSW 11 55253889 missense probably benign 0.00
R5588:Fat2 UTSW 11 55282277 missense probably damaging 1.00
R5598:Fat2 UTSW 11 55281130 missense probably damaging 1.00
R5636:Fat2 UTSW 11 55282481 missense probably damaging 1.00
R5653:Fat2 UTSW 11 55310316 missense probably damaging 1.00
R5657:Fat2 UTSW 11 55310681 nonsense probably null
R5660:Fat2 UTSW 11 55284176 missense probably benign 0.00
R5752:Fat2 UTSW 11 55289237 missense possibly damaging 0.48
R5757:Fat2 UTSW 11 55252346 missense probably damaging 1.00
R5792:Fat2 UTSW 11 55262325 missense possibly damaging 0.77
R5872:Fat2 UTSW 11 55270382 missense probably damaging 1.00
R5933:Fat2 UTSW 11 55284051 missense probably damaging 1.00
R6030:Fat2 UTSW 11 55310303 nonsense probably null
R6030:Fat2 UTSW 11 55310303 nonsense probably null
R6032:Fat2 UTSW 11 55253934 missense probably damaging 1.00
R6032:Fat2 UTSW 11 55253934 missense probably damaging 1.00
R6221:Fat2 UTSW 11 55296072 critical splice donor site probably null
R6253:Fat2 UTSW 11 55296271 missense probably damaging 1.00
R6257:Fat2 UTSW 11 55262581 missense probably benign
R6307:Fat2 UTSW 11 55281280 missense possibly damaging 0.63
R6450:Fat2 UTSW 11 55289310 missense probably damaging 0.97
R6453:Fat2 UTSW 11 55282216 missense probably benign 0.29
R6455:Fat2 UTSW 11 55270457 missense probably damaging 0.96
R6483:Fat2 UTSW 11 55296345 missense probably damaging 1.00
R6504:Fat2 UTSW 11 55262397 missense probably benign 0.00
R6520:Fat2 UTSW 11 55284988 missense probably damaging 0.99
R6525:Fat2 UTSW 11 55283800 missense probably damaging 1.00
R6617:Fat2 UTSW 11 55296105 missense probably benign 0.01
R6652:Fat2 UTSW 11 55252262 missense probably benign
R6679:Fat2 UTSW 11 55309305 missense probably damaging 1.00
R6680:Fat2 UTSW 11 55310858 nonsense probably null
R6762:Fat2 UTSW 11 55253482 splice site probably null
R6810:Fat2 UTSW 11 55282241 missense possibly damaging 0.88
R6818:Fat2 UTSW 11 55309341 missense probably benign 0.31
R6919:Fat2 UTSW 11 55282771 missense possibly damaging 0.68
R6939:Fat2 UTSW 11 55252474 nonsense probably null
R6941:Fat2 UTSW 11 55262088 missense probably benign
R7023:Fat2 UTSW 11 55310502 missense probably benign 0.00
R7027:Fat2 UTSW 11 55269433 missense probably benign 0.03
R7027:Fat2 UTSW 11 55281851 nonsense probably null
R7095:Fat2 UTSW 11 55311331 missense probably damaging 1.00
R7102:Fat2 UTSW 11 55283434 missense probably damaging 1.00
R7116:Fat2 UTSW 11 55282336 missense probably damaging 1.00
R7117:Fat2 UTSW 11 55281262 missense probably damaging 1.00
R7167:Fat2 UTSW 11 55285001 missense possibly damaging 0.48
R7213:Fat2 UTSW 11 55281045 nonsense probably null
R7246:Fat2 UTSW 11 55296382 missense probably benign 0.00
R7252:Fat2 UTSW 11 55311262 missense probably damaging 0.98
R7266:Fat2 UTSW 11 55285030 missense probably damaging 0.99
R7316:Fat2 UTSW 11 55286067 missense probably damaging 1.00
R7355:Fat2 UTSW 11 55256551 missense probably benign 0.00
R7431:Fat2 UTSW 11 55309101 missense probably damaging 1.00
R7459:Fat2 UTSW 11 55303919 missense probably damaging 1.00
R7460:Fat2 UTSW 11 55278963 missense probably damaging 1.00
R7466:Fat2 UTSW 11 55310432 missense probably damaging 1.00
R7475:Fat2 UTSW 11 55303653 missense probably benign 0.31
R7678:Fat2 UTSW 11 55282330 missense probably damaging 0.99
R7689:Fat2 UTSW 11 55309840 missense probably damaging 1.00
R7704:Fat2 UTSW 11 55284347 missense probably benign 0.03
R7710:Fat2 UTSW 11 55310763 missense probably benign 0.35
R7724:Fat2 UTSW 11 55284796 missense probably damaging 1.00
R7731:Fat2 UTSW 11 55310706 missense probably damaging 1.00
R7739:Fat2 UTSW 11 55281131 nonsense probably null
R7757:Fat2 UTSW 11 55311421 missense probably benign 0.00
R7876:Fat2 UTSW 11 55311220 missense probably benign 0.01
R7883:Fat2 UTSW 11 55253364 splice site probably null
R7924:Fat2 UTSW 11 55262787 missense probably benign 0.03
R7936:Fat2 UTSW 11 55310167 missense probably benign
R7936:Fat2 UTSW 11 55311160 nonsense probably null
R7938:Fat2 UTSW 11 55273096 missense probably damaging 1.00
R7947:Fat2 UTSW 11 55287734 missense probably damaging 1.00
R8049:Fat2 UTSW 11 55312066 missense probably benign 0.13
R8094:Fat2 UTSW 11 55296139 missense probably benign 0.06
R8157:Fat2 UTSW 11 55252084 missense possibly damaging 0.90
R8170:Fat2 UTSW 11 55270455 missense probably damaging 1.00
R8172:Fat2 UTSW 11 55287812 missense probably damaging 1.00
R8182:Fat2 UTSW 11 55284397 missense possibly damaging 0.51
R8188:Fat2 UTSW 11 55273171 missense probably damaging 0.98
R8204:Fat2 UTSW 11 55284610 missense probably benign 0.02
R8211:Fat2 UTSW 11 55312209 missense possibly damaging 0.92
R8255:Fat2 UTSW 11 55270275 missense probably benign 0.19
R8263:Fat2 UTSW 11 55284136 missense probably benign
R8269:Fat2 UTSW 11 55282709 missense possibly damaging 0.48
R8443:Fat2 UTSW 11 55311709 missense probably damaging 1.00
R8465:Fat2 UTSW 11 55256704 missense possibly damaging 0.61
R8480:Fat2 UTSW 11 55282968 missense possibly damaging 0.61
R8511:Fat2 UTSW 11 55309237 missense probably damaging 0.99
X0010:Fat2 UTSW 11 55252260 missense probably benign 0.00
X0011:Fat2 UTSW 11 55310431 missense probably damaging 0.98
X0018:Fat2 UTSW 11 55296210 missense probably damaging 1.00
X0028:Fat2 UTSW 11 55309414 missense possibly damaging 0.84
X0067:Fat2 UTSW 11 55283234 missense possibly damaging 0.48
Z1176:Fat2 UTSW 11 55282795 missense probably damaging 1.00
Z1176:Fat2 UTSW 11 55284991 missense probably damaging 1.00
Z1176:Fat2 UTSW 11 55303700 missense probably damaging 1.00
Z1176:Fat2 UTSW 11 55310121 missense probably damaging 0.96
Z1177:Fat2 UTSW 11 55278966 nonsense probably null
Predicted Primers PCR Primer
(F):5'- CCCGGATGCTTTGAATTGCG -3'
(R):5'- CTTCTGATGGGGTCTTCCAAG -3'

Sequencing Primer
(F):5'- CGGGGCATTATCATTTTCATCAG -3'
(R):5'- GCAACGGTGCCAGTGTATATC -3'
Posted On2019-09-13