Mutagenetix > Incidental Mutation

Incidental Mutation 'R7326:Ralgapa1'

568940

Institutional Source

Beutler Lab

Gene Symbol

Ralgapa1

Ensembl Gene

ENSMUSG00000021027

Gene Name

Ral GTPase activating protein, alpha subunit 1

Synonyms

Garnl1, 4930400K19Rik, 2310003F20Rik, Tulip1

MMRRC Submission

045378-MU

Accession Numbers

Essential gene?

Probably essential (E-score: 0.823) question?

Stock #

R7326 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

55602896-55821167 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to A at 55709004 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Tryptophan to Leucine at position 1129 (W1129L)

Ref Sequence

ENSEMBL: ENSMUSP00000082503 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000085385] [ENSMUST00000110687] [ENSMUST00000219432] [ENSMUST00000220367] [ENSMUST00000226244]

AlphaFold

Q6GYP7

Predicted Effect

probably damaging
Transcript: ENSMUST00000085385
AA Change: W1129L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000082503
Gene: ENSMUSG00000021027
AA Change: W1129L

Domain	Start	End	E-Value	Type
low complexity region	644	651	N/A	INTRINSIC
low complexity region	676	690	N/A	INTRINSIC
low complexity region	692	704	N/A	INTRINSIC
low complexity region	894	915	N/A	INTRINSIC
low complexity region	1386	1395	N/A	INTRINSIC
low complexity region	1784	1798	N/A	INTRINSIC
Pfam:Rap_GAP	1824	2003	7.4e-66	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000110687
AA Change: W1129L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000106315
Gene: ENSMUSG00000021027
AA Change: W1129L

Domain	Start	End	E-Value	Type
low complexity region	644	651	N/A	INTRINSIC
low complexity region	676	690	N/A	INTRINSIC
low complexity region	692	704	N/A	INTRINSIC
low complexity region	894	915	N/A	INTRINSIC
low complexity region	1386	1395	N/A	INTRINSIC
low complexity region	1784	1798	N/A	INTRINSIC
Pfam:Rap_GAP	1824	2001	1.9e-48	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000219432
AA Change: W1176L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

Predicted Effect

probably damaging
Transcript: ENSMUST00000220367
AA Change: W1129L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

Predicted Effect

possibly damaging
Transcript: ENSMUST00000226244
AA Change: W1585L

PolyPhen 2 Score 0.787 (Sensitivity: 0.85; Specificity: 0.93)

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.8%
20x: 99.2%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a major subunit of the RAL-GTPase activating protein. A similar protein in mouse binds E12, a transcriptional regulator of immunoglobulin genes. The mouse protein also functions in skeletal muscle by binding to the regulatory 14-3-3 proteins upon stimulation with insulin or muscle contraction. A pseudogene of this gene has been identified on chromosome 9. [provided by RefSeq, Oct 2016]

Allele List at MGI

Other mutations in this stock

Total: 112 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
6430531B16Rik	A	T	7: 139,978,545		probably null	Het
Abcb4	T	C	5: 8,934,226	V652A	probably benign	Het
Acvrl1	G	T	15: 101,141,072	V417L	probably damaging	Het
Add1	A	G	5: 34,619,371	R479G	probably benign	Het
Adgb	A	T	10: 10,400,574	L350Q	possibly damaging	Het
Adgrl2	A	T	3: 148,846,870	S666T	probably benign	Het
Akap9	T	A	5: 4,045,930	D2268E	possibly damaging	Het
Amigo3	C	A	9: 108,054,066	H229Q	probably benign	Het
Ano6	G	C	15: 95,864,244	Q31H	possibly damaging	Het
Ap4m1	G	A	5: 138,175,019	D180N	probably damaging	Het
Apc2	A	T	10: 80,311,740	D876V	probably damaging	Het
Apcdd1	T	A	18: 62,952,188	Y485*	probably null	Het
Aqp1	G	T	6: 55,336,851	D121Y	probably benign	Het
Bicd2	C	A	13: 49,369,609	R141S	probably benign	Het
Brpf3	C	A	17: 28,806,293	H113Q	probably benign	Het
Cacng2	A	T	15: 78,013,320	Y96*	probably null	Het
Catsperg1	G	T	7: 29,210,759	N52K	possibly damaging	Het
Celsr2	A	C	3: 108,394,995	F2606V	possibly damaging	Het
Cerkl	A	T	2: 79,332,605	N516K	probably benign	Het
Ciita	G	A	16: 10,512,288	R812H	probably damaging	Het
Cldn3	T	A	5: 134,986,983	L180Q	probably damaging	Het
Cnot6l	T	C	5: 96,077,299	I512V	probably benign	Het
Col5a2	A	T	1: 45,442,867	D32E	unknown	Het
Coro7	A	G	16: 4,632,048	V616A	probably damaging	Het
Cyp4f18	T	C	8: 71,988,654	D494G	probably benign	Het
Ddx39	T	A	8: 83,722,471	V296E	probably benign	Het
Dgkg	A	T	16: 22,548,690	H593Q	probably damaging	Het
Dhx16	T	C	17: 35,886,160	L645P	probably damaging	Het
Dnah14	A	G	1: 181,598,403	M171V	probably benign	Het
Dnhd1	G	A	7: 105,720,930	V4521I	probably damaging	Het
Dok7	A	T	5: 35,064,522	M60L	probably benign	Het
Donson	A	T	16: 91,688,711	M1K	probably null	Het
Dsp	C	T	13: 38,192,883	T1548M	probably benign	Het
Dyrk1a	A	G	16: 94,692,043	T712A	probably damaging	Het
Eef2	A	G	10: 81,181,282	T708A	probably benign	Het
Epn3	G	A	11: 94,493,780	T289I	probably benign	Het
Fam171a1	C	T	2: 3,226,472	R881*	probably null	Het
Fam71a	G	A	1: 191,164,353	T31M	probably benign	Het
Fat2	T	A	11: 55,282,304	R2528W	probably damaging	Het
Fgfr1	T	G	8: 25,573,839	F707C	probably damaging	Het
Frem2	G	C	3: 53,654,753	P778A	probably damaging	Het
Ganc	A	G	2: 120,430,599	Y255C	probably damaging	Het
Ginm1	A	T	10: 7,777,850	Y65*	probably null	Het
Gm11559	T	A	11: 99,864,881	C119S	unknown	Het
Gnai1	T	A	5: 18,289,551	H188L		Het
H6pd	C	T	4: 149,996,350	A13T	probably benign	Het
Hist1h2be	T	C	13: 23,585,923	K12E	probably benign	Het
Hoxd12	A	T	2: 74,675,246	T54S	possibly damaging	Het
Hs3st5	T	A	10: 36,833,194	L242M	probably damaging	Het
Il9r	C	A	11: 32,194,389	V139L	possibly damaging	Het
Immt	A	G	6: 71,846,369	D68G	probably damaging	Het
Itsn2	A	G	12: 4,632,985	I304V	unknown	Het
Lgr4	G	A	2: 109,996,629	W159*	probably null	Het
Lin52	G	A	12: 84,457,954	G38S	probably damaging	Het
Lpgat1	A	T	1: 191,719,453	M64L	probably benign	Het
Lrrc10b	G	T	19: 10,456,778	R180S	possibly damaging	Het
Lrrc29	T	C	8: 105,312,898	D127G	probably damaging	Het
Lrrc36	A	T	8: 105,449,769	L258F	possibly damaging	Het
Ltbp4	T	A	7: 27,329,755	Q235L	unknown	Het
Maml2	A	G	9: 13,621,607	M706V		Het
Mc5r	G	T	18: 68,339,668	C366F	probably damaging	Het
Mlip	T	C	9: 77,164,842	R244G	probably benign	Het
Muc16	T	A	9: 18,585,013	R6658S	probably benign	Het
Mup4	G	T	4: 59,960,046	H73N	possibly damaging	Het
Nf1	A	G	11: 79,564,943	M565V	probably benign	Het
Nphp1	G	A	2: 127,761,217	T382I	possibly damaging	Het
Nrcam	C	T	12: 44,564,026	T503I	possibly damaging	Het
Nwd2	A	T	5: 63,800,409	N361Y	probably damaging	Het
Olfr1045	A	G	2: 86,198,573	Y60H	probably damaging	Het
Olfr1309	A	T	2: 111,983,327	L249*	probably null	Het
Olfr308	A	G	7: 86,321,574	I126T	probably damaging	Het
Olfr461	G	T	6: 40,544,895	A28E	probably damaging	Het
Olfr518	A	T	7: 108,880,816	H263Q	probably damaging	Het
Olfr836	A	G	9: 19,121,669	Y235C	probably benign	Het
Olfr993	A	T	2: 85,414,444	V145E	probably damaging	Het
Orc5	A	G	5: 22,523,584	F308L	probably benign	Het
Padi1	T	A	4: 140,832,404	Y54F	probably benign	Het
Parp1	A	G	1: 180,569,100	K23E	possibly damaging	Het
Pate1	A	T	9: 35,685,972	V79D	possibly damaging	Het
Pcdh18	T	C	3: 49,756,860	H2R	probably benign	Het
Pcnx2	G	A	8: 125,887,083	S543F	probably damaging	Het
Pcp4l1	G	A	1: 171,174,465	A42V	possibly damaging	Het
Pnkp	T	A	7: 44,859,734	F169L	probably damaging	Het
Ppp6r3	A	T	19: 3,507,325	N254K	probably damaging	Het
Psd	A	G	19: 46,324,454	L159P	probably benign	Het
Ptprf	A	G	4: 118,231,669	Y646H	probably damaging	Het
Rab3ip	A	T	10: 116,937,633	S92T	probably benign	Het
Rabgef1	A	G	5: 130,187,351		probably benign	Het
Rhpn2	T	A	7: 35,385,463	L594Q	probably benign	Het
Rnf38	C	A	4: 44,158,989		probably benign	Het
Ryr2	T	A	13: 11,738,194	H1747L	possibly damaging	Het
Sec16a	A	G	2: 26,439,717	L13P	unknown	Het
Sppl3	C	A	5: 115,082,335	T102K	probably damaging	Het
Srgap2	A	T	1: 131,291,613	Y264*	probably null	Het
Stxbp2	T	C	8: 3,641,151	M465T		Het
Sumf2	A	G	5: 129,862,710	K305R	probably benign	Het
Susd2	T	A	10: 75,642,565	Y59F	probably benign	Het
Taco1	T	C	11: 106,072,617	V198A	probably benign	Het
Tas2r136	A	T	6: 132,777,906	M86K	possibly damaging	Het
Tbc1d10c	T	C	19: 4,184,898	E388G	possibly damaging	Het
Tmem132c	C	T	5: 127,564,059	T1098I	possibly damaging	Het
Trim3	G	T	7: 105,617,800	Y457*	probably null	Het
Ttc38	A	G	15: 85,852,861	T316A	probably benign	Het
Ubqln4	T	A	3: 88,555,910	N127K	probably benign	Het
Wdr91	A	T	6: 34,904,626	F262Y	probably damaging	Het
Zdhhc6	A	T	19: 55,302,755	C343S	possibly damaging	Het
Zfp248	A	G	6: 118,430,209	C140R	probably damaging	Het
Zfp266	T	C	9: 20,502,095	T90A	probably benign	Het
Zfp407	A	T	18: 84,559,042	D1315E	possibly damaging	Het
Zfp644	T	C	5: 106,638,277	S135G	probably benign	Het
Zscan29	A	T	2: 121,160,988	I773N	probably damaging	Het
Zswim5	T	A	4: 116,980,834	V787E	possibly damaging	Het

Other mutations in Ralgapa1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00089:Ralgapa1	APN	12	55722773	missense	probably damaging	0.98
IGL00494:Ralgapa1	APN	12	55747185	missense	probably damaging	1.00
IGL00731:Ralgapa1	APN	12	55702452	missense	possibly damaging	0.94
IGL00851:Ralgapa1	APN	12	55709575	missense	possibly damaging	0.93
IGL01133:Ralgapa1	APN	12	55642348	missense	probably damaging	1.00
IGL01133:Ralgapa1	APN	12	55642359	missense	probably damaging	0.99
IGL01354:Ralgapa1	APN	12	55777316	missense	possibly damaging	0.68
IGL01514:Ralgapa1	APN	12	55719657	missense	probably damaging	0.97
IGL02033:Ralgapa1	APN	12	55642477	missense	possibly damaging	0.69
IGL02064:Ralgapa1	APN	12	55708077	missense	probably damaging	1.00
IGL02556:Ralgapa1	APN	12	55642449	missense	possibly damaging	0.80
IGL02605:Ralgapa1	APN	12	55712665	missense	possibly damaging	0.90
IGL02657:Ralgapa1	APN	12	55673507	missense	probably damaging	1.00
IGL02676:Ralgapa1	APN	12	55676417	missense	probably damaging	1.00
IGL02894:Ralgapa1	APN	12	55717069	missense	possibly damaging	0.79
IGL02944:Ralgapa1	APN	12	55757951	missense	probably benign	0.01
Anhydrous	UTSW	12	55795778	critical splice acceptor site	probably null
Aqueous	UTSW	12	55698854	missense	probably damaging	1.00
bantam	UTSW	12	55722773	critical splice donor site	probably null
Deliquescent	UTSW	12	55782900	splice site	probably benign
wickedwarlock	UTSW	12	55777292	missense	probably null	0.99
F5770:Ralgapa1	UTSW	12	55795653	splice site	probably benign
IGL03046:Ralgapa1	UTSW	12	55695157	missense	probably damaging	1.00
R0011:Ralgapa1	UTSW	12	55786263	missense	probably damaging	0.99
R0096:Ralgapa1	UTSW	12	55739505	missense	probably damaging	1.00
R0277:Ralgapa1	UTSW	12	55677238	missense	probably damaging	0.99
R0323:Ralgapa1	UTSW	12	55677238	missense	probably damaging	0.99
R0333:Ralgapa1	UTSW	12	55782900	splice site	probably benign
R0361:Ralgapa1	UTSW	12	55676569	missense	possibly damaging	0.93
R0385:Ralgapa1	UTSW	12	55677038	missense	probably damaging	1.00
R0386:Ralgapa1	UTSW	12	55708067	missense	probably benign	0.03
R0498:Ralgapa1	UTSW	12	55689791	missense	possibly damaging	0.66
R0552:Ralgapa1	UTSW	12	55676765	missense	probably benign	0.27
R0564:Ralgapa1	UTSW	12	55782885	missense	possibly damaging	0.84
R0611:Ralgapa1	UTSW	12	55795698	missense	probably damaging	0.99
R0730:Ralgapa1	UTSW	12	55665663	missense	probably damaging	1.00
R0741:Ralgapa1	UTSW	12	55676581	missense	probably damaging	0.99
R0815:Ralgapa1	UTSW	12	55762681	nonsense	probably null
R0815:Ralgapa1	UTSW	12	55782777	splice site	probably benign
R0863:Ralgapa1	UTSW	12	55762681	nonsense	probably null
R0863:Ralgapa1	UTSW	12	55782777	splice site	probably benign
R1068:Ralgapa1	UTSW	12	55790310	critical splice donor site	probably null
R1147:Ralgapa1	UTSW	12	55702480	missense	probably damaging	1.00
R1147:Ralgapa1	UTSW	12	55702480	missense	probably damaging	1.00
R1256:Ralgapa1	UTSW	12	55762661	missense	possibly damaging	0.94
R1343:Ralgapa1	UTSW	12	55707978	missense	probably damaging	1.00
R1378:Ralgapa1	UTSW	12	55676926	missense	probably damaging	1.00
R1474:Ralgapa1	UTSW	12	55741480	missense	probably benign	0.09
R1494:Ralgapa1	UTSW	12	55684524	missense	probably damaging	0.99
R1593:Ralgapa1	UTSW	12	55770703	missense	probably damaging	1.00
R1607:Ralgapa1	UTSW	12	55741536	missense	probably damaging	1.00
R1681:Ralgapa1	UTSW	12	55762603	missense	probably benign	0.35
R1689:Ralgapa1	UTSW	12	55676767	missense	possibly damaging	0.79
R1714:Ralgapa1	UTSW	12	55642389	missense	probably damaging	1.00
R1832:Ralgapa1	UTSW	12	55757967	missense	probably benign	0.03
R1870:Ralgapa1	UTSW	12	55677032	missense	possibly damaging	0.66
R2040:Ralgapa1	UTSW	12	55786322	missense	probably damaging	1.00
R2043:Ralgapa1	UTSW	12	55677026	missense	probably damaging	0.99
R2046:Ralgapa1	UTSW	12	55695160	missense	probably damaging	1.00
R2109:Ralgapa1	UTSW	12	55776188	missense	possibly damaging	0.90
R2114:Ralgapa1	UTSW	12	55786349	critical splice acceptor site	probably null
R2115:Ralgapa1	UTSW	12	55786349	critical splice acceptor site	probably null
R2202:Ralgapa1	UTSW	12	55612800	splice site	probably null
R2203:Ralgapa1	UTSW	12	55612800	splice site	probably null
R2233:Ralgapa1	UTSW	12	55717071	missense	probably benign	0.13
R2235:Ralgapa1	UTSW	12	55717071	missense	probably benign	0.13
R2341:Ralgapa1	UTSW	12	55677124	missense	possibly damaging	0.66
R2507:Ralgapa1	UTSW	12	55718201	missense	probably damaging	1.00
R2508:Ralgapa1	UTSW	12	55718201	missense	probably damaging	1.00
R2972:Ralgapa1	UTSW	12	55820755	missense	possibly damaging	0.61
R3160:Ralgapa1	UTSW	12	55709586	missense	probably damaging	1.00
R3162:Ralgapa1	UTSW	12	55709586	missense	probably damaging	1.00
R3401:Ralgapa1	UTSW	12	55659137	missense	possibly damaging	0.66
R3416:Ralgapa1	UTSW	12	55770613	splice site	probably benign
R3499:Ralgapa1	UTSW	12	55695143	splice site	probably benign
R3799:Ralgapa1	UTSW	12	55659130	missense	probably damaging	1.00
R3948:Ralgapa1	UTSW	12	55698767	missense	probably damaging	1.00
R4039:Ralgapa1	UTSW	12	55795701	missense	probably damaging	0.99
R4120:Ralgapa1	UTSW	12	55640644	missense	probably damaging	1.00
R4165:Ralgapa1	UTSW	12	55640644	missense	probably damaging	1.00
R4166:Ralgapa1	UTSW	12	55640644	missense	probably damaging	1.00
R4212:Ralgapa1	UTSW	12	55739330	critical splice donor site	probably null
R4232:Ralgapa1	UTSW	12	55640644	missense	probably damaging	1.00
R4233:Ralgapa1	UTSW	12	55640644	missense	probably damaging	1.00
R4234:Ralgapa1	UTSW	12	55640644	missense	probably damaging	1.00
R4235:Ralgapa1	UTSW	12	55640644	missense	probably damaging	1.00
R4399:Ralgapa1	UTSW	12	55795778	critical splice acceptor site	probably null
R4698:Ralgapa1	UTSW	12	55677276	splice site	probably null
R4715:Ralgapa1	UTSW	12	55693458	missense	probably damaging	1.00
R4755:Ralgapa1	UTSW	12	55712748	missense	probably damaging	1.00
R4810:Ralgapa1	UTSW	12	55794993	critical splice donor site	probably null
R4827:Ralgapa1	UTSW	12	55676437	missense	probably damaging	1.00
R4849:Ralgapa1	UTSW	12	55698803	missense	probably damaging	0.99
R4934:Ralgapa1	UTSW	12	55762574	missense	possibly damaging	0.94
R5006:Ralgapa1	UTSW	12	55718114	missense	probably benign	0.02
R5114:Ralgapa1	UTSW	12	55612723	missense	possibly damaging	0.84
R5140:Ralgapa1	UTSW	12	55776152	missense	probably damaging	1.00
R5140:Ralgapa1	UTSW	12	55665674	missense	probably damaging	1.00
R5168:Ralgapa1	UTSW	12	55758032	missense	probably benign	0.05
R5407:Ralgapa1	UTSW	12	55676797	missense	possibly damaging	0.93
R5441:Ralgapa1	UTSW	12	55719623	missense	probably damaging	1.00
R5473:Ralgapa1	UTSW	12	55676710	missense	probably benign	0.41
R5624:Ralgapa1	UTSW	12	55612738	missense	probably damaging	1.00
R5766:Ralgapa1	UTSW	12	55820766	start codon destroyed	probably null	0.99
R5826:Ralgapa1	UTSW	12	55677113	missense	probably damaging	1.00
R5950:Ralgapa1	UTSW	12	55738265	missense	possibly damaging	0.58
R5980:Ralgapa1	UTSW	12	55770616	splice site	probably null
R6019:Ralgapa1	UTSW	12	55684042	missense	possibly damaging	0.92
R6065:Ralgapa1	UTSW	12	55757924	critical splice donor site	probably null
R6326:Ralgapa1	UTSW	12	55747146	missense	probably damaging	1.00
R6355:Ralgapa1	UTSW	12	55698854	missense	probably damaging	1.00
R6408:Ralgapa1	UTSW	12	55683910	nonsense	probably null
R6448:Ralgapa1	UTSW	12	55719661	missense	probably benign	0.14
R6453:Ralgapa1	UTSW	12	55738319	missense	probably damaging	1.00
R6590:Ralgapa1	UTSW	12	55722773	critical splice donor site	probably null
R6690:Ralgapa1	UTSW	12	55722773	critical splice donor site	probably null
R6738:Ralgapa1	UTSW	12	55762727	missense	probably damaging	1.00
R6836:Ralgapa1	UTSW	12	55604273	splice site	probably null
R6936:Ralgapa1	UTSW	12	55786212	missense	probably damaging	0.99
R6945:Ralgapa1	UTSW	12	55776191	missense	possibly damaging	0.64
R7028:Ralgapa1	UTSW	12	55758059	missense	probably damaging	1.00
R7075:Ralgapa1	UTSW	12	55820723	missense	possibly damaging	0.66
R7076:Ralgapa1	UTSW	12	55721576	missense	possibly damaging	0.82
R7098:Ralgapa1	UTSW	12	55790310	critical splice donor site	probably null
R7231:Ralgapa1	UTSW	12	55604191	missense	probably damaging	1.00
R7254:Ralgapa1	UTSW	12	55695193	missense	probably damaging	1.00
R7485:Ralgapa1	UTSW	12	55712672	missense	probably damaging	1.00
R7580:Ralgapa1	UTSW	12	55718228	missense	probably benign	0.00
R7677:Ralgapa1	UTSW	12	55659143	missense	probably damaging	0.96
R7702:Ralgapa1	UTSW	12	55709555	missense	probably damaging	1.00
R7702:Ralgapa1	UTSW	12	55709556	missense	probably damaging	1.00
R7707:Ralgapa1	UTSW	12	55777292	missense	probably null	0.99
R7723:Ralgapa1	UTSW	12	55741513	missense	probably benign
R7763:Ralgapa1	UTSW	12	55757955	missense	probably benign	0.28
R7791:Ralgapa1	UTSW	12	55741519	missense	probably damaging	0.97
R7812:Ralgapa1	UTSW	12	55719628	missense	possibly damaging	0.67
R7868:Ralgapa1	UTSW	12	55612638	missense	probably benign	0.00
R7895:Ralgapa1	UTSW	12	55747149	missense	probably benign	0.44
R7896:Ralgapa1	UTSW	12	55697878	missense	probably benign	0.01
R8004:Ralgapa1	UTSW	12	55702457	missense	probably damaging	0.99
R8094:Ralgapa1	UTSW	12	55782846	missense	probably damaging	0.99
R8213:Ralgapa1	UTSW	12	55722914	missense	probably damaging	0.99
R8307:Ralgapa1	UTSW	12	55741523	missense	probably damaging	0.99
R8423:Ralgapa1	UTSW	12	55659062	missense	probably damaging	0.99
R8462:Ralgapa1	UTSW	12	55676518	missense	possibly damaging	0.90
R8469:Ralgapa1	UTSW	12	55739413	missense	probably damaging	1.00
R8675:Ralgapa1	UTSW	12	55738217	missense	possibly damaging	0.93
R8802:Ralgapa1	UTSW	12	55738316	missense	probably damaging	0.99
R8937:Ralgapa1	UTSW	12	55702560	missense	probably damaging	0.96
R8953:Ralgapa1	UTSW	12	55820761	missense	probably damaging	0.99
R8974:Ralgapa1	UTSW	12	55677006	missense	probably benign
R9011:Ralgapa1	UTSW	12	55605529	intron	probably benign
R9089:Ralgapa1	UTSW	12	55676566	missense	probably damaging	0.97
R9124:Ralgapa1	UTSW	12	55735096	missense	probably damaging	1.00
R9254:Ralgapa1	UTSW	12	55722798	missense	probably damaging	1.00
R9320:Ralgapa1	UTSW	12	55709058	missense	possibly damaging	0.59
R9379:Ralgapa1	UTSW	12	55722798	missense	probably damaging	1.00
R9446:Ralgapa1	UTSW	12	55708023	missense	probably damaging	0.97
R9684:Ralgapa1	UTSW	12	55612700	missense	possibly damaging	0.63
Z1176:Ralgapa1	UTSW	12	55709080	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- GAAACTAAGTGTGCTTGAAGACC -3'
(R):5'- GACAGGATTCAGCTTCTGTTTAAGG -3'

Sequencing Primer
(F):5'- GTCCTGGAACTCACTCTGAAG -3'
(R):5'- GCTTCTGTTTAAGGTAAAACAACTGG -3'

Posted On

2019-09-13