Mutagenetix > Incidental Mutation

Incidental Mutation 'R7326:Dsp'

568944

Institutional Source

Beutler Lab

Gene Symbol

Dsp

Ensembl Gene

ENSMUSG00000054889

Gene Name

desmoplakin

Synonyms

5730453H04Rik, DP, 2300002E22Rik

MMRRC Submission

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R7326 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

38151294-38198577 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 38192883 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Threonine to Methionine at position 1548 (T1548M)

Ref Sequence

ENSEMBL: ENSMUSP00000115062 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000124830] [ENSMUST00000127906]

AlphaFold

no structure available at present

Predicted Effect

probably benign
Transcript: ENSMUST00000124830
AA Change: T1548M

PolyPhen 2 Score 0.008 (Sensitivity: 0.96; Specificity: 0.76)

SMART Domains

Protein: ENSMUSP00000115062
Gene: ENSMUSG00000054889
AA Change: T1548M

Domain	Start	End	E-Value	Type
Blast:SPEC	193	282	2e-51	BLAST
SPEC	285	385	6.03e-2	SMART
Blast:SPEC	391	557	1e-96	BLAST
Blast:SPEC	783	894	4e-34	BLAST
SPEC	901	1030	1.39e0	SMART
coiled coil region	1033	1370	N/A	INTRINSIC
coiled coil region	1394	1956	N/A	INTRINSIC
low complexity region	1997	2011	N/A	INTRINSIC
PLEC	2021	2057	3.33e-1	SMART
PLEC	2058	2095	3.76e-9	SMART
PLEC	2096	2133	4.09e-10	SMART
PLEC	2134	2171	2.09e-7	SMART
PLEC	2175	2209	4.83e1	SMART
PLEC	2210	2245	5.67e1	SMART
PLEC	2263	2300	1.22e-8	SMART
PLEC	2301	2338	1.16e-9	SMART
PLEC	2339	2376	1.12e-7	SMART
PLEC	2377	2414	1.56e-6	SMART
PLEC	2418	2452	1.42e0	SMART
PLEC	2468	2505	3.7e-8	SMART
low complexity region	2507	2517	N/A	INTRINSIC
PLEC	2519	2556	3.73e-4	SMART
low complexity region	2577	2593	N/A	INTRINSIC
PLEC	2622	2659	1.46e-6	SMART
PLEC	2660	2697	6.69e-15	SMART
PLEC	2698	2735	1.98e2	SMART
PLEC	2736	2773	2.35e-10	SMART
PLEC	2774	2811	1.39e-3	SMART
low complexity region	2835	2860	N/A	INTRINSIC
low complexity region	2867	2879	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000127906

SMART Domains

Protein: ENSMUSP00000117252
Gene: ENSMUSG00000054889

Domain	Start	End	E-Value	Type
Blast:SPEC	193	282	2e-51	BLAST
SPEC	285	385	6.03e-2	SMART
Blast:SPEC	391	557	1e-95	BLAST
Blast:SPEC	783	894	3e-34	BLAST
SPEC	901	1030	1.39e0	SMART
coiled coil region	1033	1357	N/A	INTRINSIC
low complexity region	1398	1412	N/A	INTRINSIC
PLEC	1422	1458	3.33e-1	SMART
PLEC	1459	1496	3.76e-9	SMART
PLEC	1497	1534	4.09e-10	SMART
PLEC	1535	1572	2.09e-7	SMART
PLEC	1576	1610	4.83e1	SMART
PLEC	1611	1646	5.67e1	SMART
PLEC	1664	1701	1.22e-8	SMART
PLEC	1702	1739	1.16e-9	SMART
PLEC	1740	1777	1.12e-7	SMART
PLEC	1778	1815	1.56e-6	SMART
PLEC	1819	1853	1.42e0	SMART
PLEC	1869	1906	3.7e-8	SMART
low complexity region	1908	1918	N/A	INTRINSIC
PLEC	1920	1957	3.73e-4	SMART
low complexity region	1978	1994	N/A	INTRINSIC
PLEC	2023	2060	1.46e-6	SMART
PLEC	2061	2098	6.69e-15	SMART
PLEC	2099	2136	1.98e2	SMART
PLEC	2137	2174	2.35e-10	SMART
PLEC	2175	2212	1.39e-3	SMART
low complexity region	2236	2261	N/A	INTRINSIC
low complexity region	2268	2280	N/A	INTRINSIC

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.8%
20x: 99.2%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that anchors intermediate filaments to desmosomal plaques and forms an obligate component of functional desmosomes. Mutations in this gene are the cause of several cardiomyopathies and keratodermas, including skin fragility-woolly hair syndrome. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jan 2016]
PHENOTYPE: Homozygous targeted null mutants die by embryonic day E6.5 due to instability of desmosomes and tissue integrity; rescue by aggregation with wild-type tetraploid morulae increase embyronic survival with noted major defects in heart muscle, neuroepithelium and epidermis; conditional knockouts that are epidermal-specific have compositionally altered epidermal desmosomes. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 112 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
6430531B16Rik	A	T	7: 139,978,545		probably null	Het
Abcb4	T	C	5: 8,934,226	V652A	probably benign	Het
Acvrl1	G	T	15: 101,141,072	V417L	probably damaging	Het
Add1	A	G	5: 34,619,371	R479G	probably benign	Het
Adgb	A	T	10: 10,400,574	L350Q	possibly damaging	Het
Adgrl2	A	T	3: 148,846,870	S666T	probably benign	Het
Akap9	T	A	5: 4,045,930	D2268E	possibly damaging	Het
Amigo3	C	A	9: 108,054,066	H229Q	probably benign	Het
Ano6	G	C	15: 95,864,244	Q31H	possibly damaging	Het
Ap4m1	G	A	5: 138,175,019	D180N	probably damaging	Het
Apc2	A	T	10: 80,311,740	D876V	probably damaging	Het
Apcdd1	T	A	18: 62,952,188	Y485*	probably null	Het
Aqp1	G	T	6: 55,336,851	D121Y	probably benign	Het
Bicd2	C	A	13: 49,369,609	R141S	probably benign	Het
Brpf3	C	A	17: 28,806,293	H113Q	probably benign	Het
Cacng2	A	T	15: 78,013,320	Y96*	probably null	Het
Catsperg1	G	T	7: 29,210,759	N52K	possibly damaging	Het
Celsr2	A	C	3: 108,394,995	F2606V	possibly damaging	Het
Cerkl	A	T	2: 79,332,605	N516K	probably benign	Het
Ciita	G	A	16: 10,512,288	R812H	probably damaging	Het
Cldn3	T	A	5: 134,986,983	L180Q	probably damaging	Het
Cnot6l	T	C	5: 96,077,299	I512V	probably benign	Het
Col5a2	A	T	1: 45,442,867	D32E	unknown	Het
Coro7	A	G	16: 4,632,048	V616A	probably damaging	Het
Cyp4f18	T	C	8: 71,988,654	D494G	probably benign	Het
Ddx39	T	A	8: 83,722,471	V296E	probably benign	Het
Dgkg	A	T	16: 22,548,690	H593Q	probably damaging	Het
Dhx16	T	C	17: 35,886,160	L645P	probably damaging	Het
Dnah14	A	G	1: 181,598,403	M171V	probably benign	Het
Dnhd1	G	A	7: 105,720,930	V4521I	probably damaging	Het
Dok7	A	T	5: 35,064,522	M60L	probably benign	Het
Donson	A	T	16: 91,688,711	M1K	probably null	Het
Dyrk1a	A	G	16: 94,692,043	T712A	probably damaging	Het
Eef2	A	G	10: 81,181,282	T708A	probably benign	Het
Epn3	G	A	11: 94,493,780	T289I	probably benign	Het
Fam171a1	C	T	2: 3,226,472	R881*	probably null	Het
Fam71a	G	A	1: 191,164,353	T31M	probably benign	Het
Fat2	T	A	11: 55,282,304	R2528W	probably damaging	Het
Fgfr1	T	G	8: 25,573,839	F707C	probably damaging	Het
Frem2	G	C	3: 53,654,753	P778A	probably damaging	Het
Ganc	A	G	2: 120,430,599	Y255C	probably damaging	Het
Ginm1	A	T	10: 7,777,850	Y65*	probably null	Het
Gm11559	T	A	11: 99,864,881	C119S	unknown	Het
Gnai1	T	A	5: 18,289,551	H188L		Het
H6pd	C	T	4: 149,996,350	A13T	probably benign	Het
Hist1h2be	T	C	13: 23,585,923	K12E	probably benign	Het
Hoxd12	A	T	2: 74,675,246	T54S	possibly damaging	Het
Hs3st5	T	A	10: 36,833,194	L242M	probably damaging	Het
Il9r	C	A	11: 32,194,389	V139L	possibly damaging	Het
Immt	A	G	6: 71,846,369	D68G	probably damaging	Het
Itsn2	A	G	12: 4,632,985	I304V	unknown	Het
Lgr4	G	A	2: 109,996,629	W159*	probably null	Het
Lin52	G	A	12: 84,457,954	G38S	probably damaging	Het
Lpgat1	A	T	1: 191,719,453	M64L	probably benign	Het
Lrrc10b	G	T	19: 10,456,778	R180S	possibly damaging	Het
Lrrc29	T	C	8: 105,312,898	D127G	probably damaging	Het
Lrrc36	A	T	8: 105,449,769	L258F	possibly damaging	Het
Ltbp4	T	A	7: 27,329,755	Q235L	unknown	Het
Maml2	A	G	9: 13,621,607	M706V		Het
Mc5r	G	T	18: 68,339,668	C366F	probably damaging	Het
Mlip	T	C	9: 77,164,842	R244G	probably benign	Het
Muc16	T	A	9: 18,585,013	R6658S	probably benign	Het
Mup4	G	T	4: 59,960,046	H73N	possibly damaging	Het
Nf1	A	G	11: 79,564,943	M565V	probably benign	Het
Nphp1	G	A	2: 127,761,217	T382I	possibly damaging	Het
Nrcam	C	T	12: 44,564,026	T503I	possibly damaging	Het
Nwd2	A	T	5: 63,800,409	N361Y	probably damaging	Het
Olfr1045	A	G	2: 86,198,573	Y60H	probably damaging	Het
Olfr1309	A	T	2: 111,983,327	L249*	probably null	Het
Olfr308	A	G	7: 86,321,574	I126T	probably damaging	Het
Olfr461	G	T	6: 40,544,895	A28E	probably damaging	Het
Olfr518	A	T	7: 108,880,816	H263Q	probably damaging	Het
Olfr836	A	G	9: 19,121,669	Y235C	probably benign	Het
Olfr993	A	T	2: 85,414,444	V145E	probably damaging	Het
Orc5	A	G	5: 22,523,584	F308L	probably benign	Het
Padi1	T	A	4: 140,832,404	Y54F	probably benign	Het
Parp1	A	G	1: 180,569,100	K23E	possibly damaging	Het
Pate1	A	T	9: 35,685,972	V79D	possibly damaging	Het
Pcdh18	T	C	3: 49,756,860	H2R	probably benign	Het
Pcnx2	G	A	8: 125,887,083	S543F	probably damaging	Het
Pcp4l1	G	A	1: 171,174,465	A42V	possibly damaging	Het
Pnkp	T	A	7: 44,859,734	F169L	probably damaging	Het
Ppp6r3	A	T	19: 3,507,325	N254K	probably damaging	Het
Psd	A	G	19: 46,324,454	L159P	probably benign	Het
Ptprf	A	G	4: 118,231,669	Y646H	probably damaging	Het
Rab3ip	A	T	10: 116,937,633	S92T	probably benign	Het
Rabgef1	A	G	5: 130,187,351		probably benign	Het
Ralgapa1	C	A	12: 55,709,004	W1129L	probably damaging	Het
Rhpn2	T	A	7: 35,385,463	L594Q	probably benign	Het
Rnf38	C	A	4: 44,158,989		probably benign	Het
Ryr2	T	A	13: 11,738,194	H1747L	possibly damaging	Het
Sec16a	A	G	2: 26,439,717	L13P	unknown	Het
Sppl3	C	A	5: 115,082,335	T102K	probably damaging	Het
Srgap2	A	T	1: 131,291,613	Y264*	probably null	Het
Stxbp2	T	C	8: 3,641,151	M465T		Het
Sumf2	A	G	5: 129,862,710	K305R	probably benign	Het
Susd2	T	A	10: 75,642,565	Y59F	probably benign	Het
Taco1	T	C	11: 106,072,617	V198A	probably benign	Het
Tas2r136	A	T	6: 132,777,906	M86K	possibly damaging	Het
Tbc1d10c	T	C	19: 4,184,898	E388G	possibly damaging	Het
Tmem132c	C	T	5: 127,564,059	T1098I	possibly damaging	Het
Trim3	G	T	7: 105,617,800	Y457*	probably null	Het
Ttc38	A	G	15: 85,852,861	T316A	probably benign	Het
Ubqln4	T	A	3: 88,555,910	N127K	probably benign	Het
Wdr91	A	T	6: 34,904,626	F262Y	probably damaging	Het
Zdhhc6	A	T	19: 55,302,755	C343S	possibly damaging	Het
Zfp248	A	G	6: 118,430,209	C140R	probably damaging	Het
Zfp266	T	C	9: 20,502,095	T90A	probably benign	Het
Zfp407	A	T	18: 84,559,042	D1315E	possibly damaging	Het
Zfp644	T	C	5: 106,638,277	S135G	probably benign	Het
Zscan29	A	T	2: 121,160,988	I773N	probably damaging	Het
Zswim5	T	A	4: 116,980,834	V787E	possibly damaging	Het

Other mutations in Dsp

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00502:Dsp	APN	13	38197846	missense	probably damaging	0.99
IGL01337:Dsp	APN	13	38192687	missense	probably benign	0.44
IGL01371:Dsp	APN	13	38193617	missense	probably benign	0.13
IGL01473:Dsp	APN	13	38167571	missense	probably damaging	0.99
IGL01660:Dsp	APN	13	38176495	missense	possibly damaging	0.90
IGL01723:Dsp	APN	13	38179084	missense	probably damaging	1.00
IGL01999:Dsp	APN	13	38181186	missense	probably damaging	0.99
IGL02313:Dsp	APN	13	38196523	nonsense	probably null
IGL02833:Dsp	APN	13	38192921	missense	possibly damaging	0.56
IGL03050:Dsp	APN	13	38188445	splice site	probably benign
IGL03353:Dsp	APN	13	38186695	missense	probably damaging	1.00
R0052:Dsp	UTSW	13	38197364	missense	possibly damaging	0.93
R0052:Dsp	UTSW	13	38197364	missense	possibly damaging	0.93
R0078:Dsp	UTSW	13	38196017	missense	probably benign	0.22
R0230:Dsp	UTSW	13	38197705	missense	probably benign	0.03
R0234:Dsp	UTSW	13	38187893	missense	probably benign	0.13
R0234:Dsp	UTSW	13	38187893	missense	probably benign	0.13
R0285:Dsp	UTSW	13	38172794	missense	probably benign
R0326:Dsp	UTSW	13	38192870	nonsense	probably null
R0332:Dsp	UTSW	13	38182228	nonsense	probably null
R0471:Dsp	UTSW	13	38193350	nonsense	probably null
R0567:Dsp	UTSW	13	38192438	missense	probably benign	0.01
R0611:Dsp	UTSW	13	38187741	missense	probably damaging	1.00
R0718:Dsp	UTSW	13	38196764	missense	possibly damaging	0.80
R0926:Dsp	UTSW	13	38183218	missense	probably damaging	0.97
R1078:Dsp	UTSW	13	38183106	splice site	probably benign
R1183:Dsp	UTSW	13	38191740	nonsense	probably null
R1188:Dsp	UTSW	13	38194963	missense	probably damaging	1.00
R1419:Dsp	UTSW	13	38186695	missense	probably damaging	1.00
R1445:Dsp	UTSW	13	38191931	missense	probably damaging	0.98
R1467:Dsp	UTSW	13	38192712	missense	probably benign	0.00
R1467:Dsp	UTSW	13	38192712	missense	probably benign	0.00
R1478:Dsp	UTSW	13	38181138	missense	probably damaging	1.00
R1568:Dsp	UTSW	13	38175147	missense	probably damaging	1.00
R1572:Dsp	UTSW	13	38195738	missense	probably damaging	1.00
R1676:Dsp	UTSW	13	38193374	nonsense	probably null
R1736:Dsp	UTSW	13	38192990	missense	probably benign	0.01
R1776:Dsp	UTSW	13	38196617	missense	probably damaging	0.99
R1829:Dsp	UTSW	13	38193195	missense	probably damaging	1.00
R1878:Dsp	UTSW	13	38164855	missense	possibly damaging	0.53
R2013:Dsp	UTSW	13	38191458	missense	probably damaging	1.00
R2161:Dsp	UTSW	13	38196451	missense	probably damaging	1.00
R2187:Dsp	UTSW	13	38176407	missense	probably damaging	1.00
R2295:Dsp	UTSW	13	38197046	missense	probably benign	0.28
R2495:Dsp	UTSW	13	38193477	missense	possibly damaging	0.91
R2566:Dsp	UTSW	13	38196404	missense	probably damaging	1.00
R2888:Dsp	UTSW	13	38192248	missense	possibly damaging	0.92
R3012:Dsp	UTSW	13	38193342	missense	possibly damaging	0.61
R3614:Dsp	UTSW	13	38177199	missense	probably damaging	0.98
R3725:Dsp	UTSW	13	38194689	splice site	probably null
R3725:Dsp	UTSW	13	38197618	missense	probably benign	0.00
R3797:Dsp	UTSW	13	38177284	critical splice donor site	probably null
R3841:Dsp	UTSW	13	38197705	missense	probably benign
R4030:Dsp	UTSW	13	38191428	missense	possibly damaging	0.84
R4124:Dsp	UTSW	13	38186713	missense	probably damaging	1.00
R4279:Dsp	UTSW	13	38185231	missense	probably damaging	1.00
R4334:Dsp	UTSW	13	38196664	missense	possibly damaging	0.46
R4419:Dsp	UTSW	13	38195132	missense	probably damaging	1.00
R4615:Dsp	UTSW	13	38191632	missense	probably damaging	0.98
R4627:Dsp	UTSW	13	38168641	missense	probably benign	0.01
R4639:Dsp	UTSW	13	38196784	missense	probably damaging	1.00
R4687:Dsp	UTSW	13	38191619	missense	probably damaging	1.00
R4735:Dsp	UTSW	13	38196040	missense	probably damaging	0.99
R4746:Dsp	UTSW	13	38195104	missense	possibly damaging	0.51
R4772:Dsp	UTSW	13	38167528	nonsense	probably null
R4830:Dsp	UTSW	13	38192864	missense	probably benign
R4850:Dsp	UTSW	13	38192469	missense	probably damaging	1.00
R4959:Dsp	UTSW	13	38191710	missense	probably benign	0.41
R4963:Dsp	UTSW	13	38197870	missense	probably damaging	0.99
R4969:Dsp	UTSW	13	38192910	missense	probably benign	0.00
R4978:Dsp	UTSW	13	38182234	missense	probably damaging	1.00
R4989:Dsp	UTSW	13	38197702	missense	possibly damaging	0.93
R5068:Dsp	UTSW	13	38197123	missense	possibly damaging	0.78
R5069:Dsp	UTSW	13	38197123	missense	possibly damaging	0.78
R5070:Dsp	UTSW	13	38197123	missense	possibly damaging	0.78
R5133:Dsp	UTSW	13	38197702	missense	possibly damaging	0.93
R5138:Dsp	UTSW	13	38183298	missense	probably benign	0.37
R5138:Dsp	UTSW	13	38195845	missense	possibly damaging	0.50
R5153:Dsp	UTSW	13	38182306	missense	probably damaging	1.00
R5199:Dsp	UTSW	13	38192902	nonsense	probably null
R5226:Dsp	UTSW	13	38186770	missense	probably damaging	0.99
R5265:Dsp	UTSW	13	38195183	missense	possibly damaging	0.95
R5371:Dsp	UTSW	13	38194889	missense	probably damaging	0.97
R5484:Dsp	UTSW	13	38184038	missense	possibly damaging	0.48
R5534:Dsp	UTSW	13	38195842	missense	probably benign	0.01
R5569:Dsp	UTSW	13	38192652	missense	probably benign	0.01
R5854:Dsp	UTSW	13	38167501	splice site	probably null
R5910:Dsp	UTSW	13	38192469	missense	possibly damaging	0.95
R5929:Dsp	UTSW	13	38195434	missense	possibly damaging	0.92
R5940:Dsp	UTSW	13	38196026	missense	possibly damaging	0.70
R5948:Dsp	UTSW	13	38195401	missense	possibly damaging	0.95
R5955:Dsp	UTSW	13	38194958	missense	possibly damaging	0.73
R5970:Dsp	UTSW	13	38195702	missense	possibly damaging	0.93
R6054:Dsp	UTSW	13	38167609	missense	probably benign	0.00
R6113:Dsp	UTSW	13	38192047	missense	probably damaging	1.00
R6139:Dsp	UTSW	13	38192406	missense	probably damaging	0.97
R6328:Dsp	UTSW	13	38197006	nonsense	probably null
R6527:Dsp	UTSW	13	38195873	missense	probably damaging	1.00
R6573:Dsp	UTSW	13	38196862	missense	probably damaging	1.00
R6628:Dsp	UTSW	13	38167622	missense	possibly damaging	0.73
R6738:Dsp	UTSW	13	38192210	missense	possibly damaging	0.87
R6898:Dsp	UTSW	13	38192217	missense	possibly damaging	0.59
R6919:Dsp	UTSW	13	38167655	missense	possibly damaging	0.84
R6951:Dsp	UTSW	13	38167646	missense	possibly damaging	0.95
R7017:Dsp	UTSW	13	38186707	missense	probably benign	0.02
R7022:Dsp	UTSW	13	38191740	missense	probably benign	0.06
R7135:Dsp	UTSW	13	38179073	missense	probably damaging	1.00
R7192:Dsp	UTSW	13	38195593	missense	probably benign	0.09
R7211:Dsp	UTSW	13	38188535	critical splice donor site	probably null
R7251:Dsp	UTSW	13	38193548	missense	probably benign	0.02
R7369:Dsp	UTSW	13	38197525	missense	possibly damaging	0.82
R7376:Dsp	UTSW	13	38172843	missense	probably damaging	1.00
R7406:Dsp	UTSW	13	38197196	missense	possibly damaging	0.63
R7439:Dsp	UTSW	13	38176502	critical splice donor site	probably null
R7439:Dsp	UTSW	13	38195449	missense	probably benign	0.00
R7441:Dsp	UTSW	13	38195449	missense	probably benign	0.00
R7477:Dsp	UTSW	13	38172863	missense	probably damaging	1.00
R7535:Dsp	UTSW	13	38192789	missense	probably benign	0.05
R7558:Dsp	UTSW	13	38168766	missense	probably benign	0.02
R7600:Dsp	UTSW	13	38191715	missense	probably damaging	1.00
R7616:Dsp	UTSW	13	38191482	missense	probably damaging	0.98
R7702:Dsp	UTSW	13	38175207	missense	possibly damaging	0.83
R7738:Dsp	UTSW	13	38185175	missense	probably damaging	0.97
R7815:Dsp	UTSW	13	38191470	missense	probably benign	0.31
R7882:Dsp	UTSW	13	38184018	missense	possibly damaging	0.76
R7917:Dsp	UTSW	13	38167639	nonsense	probably null
R7971:Dsp	UTSW	13	38192523	missense	probably damaging	0.97
R8104:Dsp	UTSW	13	38168624	missense	probably benign	0.03
R8176:Dsp	UTSW	13	38192810	missense	possibly damaging	0.56
R8303:Dsp	UTSW	13	38197343	missense	probably benign
R8323:Dsp	UTSW	13	38172830	missense	possibly damaging	0.80
R8326:Dsp	UTSW	13	38191635	missense	probably damaging	1.00
R8358:Dsp	UTSW	13	38192481	missense	possibly damaging	0.92
R8410:Dsp	UTSW	13	38196815	missense	possibly damaging	0.94
R8552:Dsp	UTSW	13	38185141	missense	probably damaging	0.98
R8713:Dsp	UTSW	13	38168725	missense	probably damaging	0.99
R8801:Dsp	UTSW	13	38197526	missense	possibly damaging	0.81
R8900:Dsp	UTSW	13	38181179	missense	probably damaging	0.99
R8901:Dsp	UTSW	13	38181179	missense	probably damaging	0.99
R8968:Dsp	UTSW	13	38151620	missense	possibly damaging	0.83
R9014:Dsp	UTSW	13	38192724	missense	possibly damaging	0.83
R9021:Dsp	UTSW	13	38196832	missense	possibly damaging	0.61
R9030:Dsp	UTSW	13	38168697	missense	probably damaging	1.00
R9124:Dsp	UTSW	13	38193300	missense	probably benign	0.42
R9129:Dsp	UTSW	13	38193150	missense	probably benign	0.09
R9143:Dsp	UTSW	13	38193361	missense	probably benign	0.05
R9450:Dsp	UTSW	13	38192403	missense	probably damaging	1.00
R9488:Dsp	UTSW	13	38193242	missense	probably benign	0.04
R9514:Dsp	UTSW	13	38187805	missense	probably benign	0.02
R9789:Dsp	UTSW	13	38183961	missense	probably benign	0.03
R9792:Dsp	UTSW	13	38195518	missense	possibly damaging	0.87
X0023:Dsp	UTSW	13	38197684	missense	probably benign	0.00
X0024:Dsp	UTSW	13	38193255	missense	probably benign	0.04
X0027:Dsp	UTSW	13	38186646	missense	possibly damaging	0.68
X0067:Dsp	UTSW	13	38182312	missense	possibly damaging	0.85
Z1176:Dsp	UTSW	13	38197190	missense	possibly damaging	0.81
Z1177:Dsp	UTSW	13	38151689	missense	probably benign	0.01
Z1177:Dsp	UTSW	13	38192854	frame shift	probably null

Predicted Primers

PCR Primer
(F):5'- TGCCAAGACCATCCAGGATAAG -3'
(R):5'- CTTTCAAAGACCTCCTCATGGC -3'

Sequencing Primer
(F):5'- CCATCCAGGATAAGAACAAGGAGATC -3'
(R):5'- GACCTCCTCATGGCCTCCAG -3'

Posted On

2019-09-13