Incidental Mutation 'R7327:Orc1'
ID568973
Institutional Source Beutler Lab
Gene Symbol Orc1
Ensembl Gene ENSMUSG00000028587
Gene Nameorigin recognition complex, subunit 1
SynonymsMmORC1, Orc1l
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7327 (G1)
Quality Score225.009
Status Validated
Chromosome4
Chromosomal Location108579423-108614833 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 108588714 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 10 (T10A)
Ref Sequence ENSEMBL: ENSMUSP00000099805 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000102744]
PDB Structure
Structure of free mouse ORC1 BAH domain [X-RAY DIFFRACTION]
Structure of mouse ORC1 BAH domain bound to H4K20me2 [X-RAY DIFFRACTION]
Predicted Effect probably benign
Transcript: ENSMUST00000102744
AA Change: T10A

PolyPhen 2 Score 0.010 (Sensitivity: 0.96; Specificity: 0.77)
SMART Domains Protein: ENSMUSP00000099805
Gene: ENSMUSG00000028587
AA Change: T10A

DomainStartEndE-ValueType
BAH 44 170 1.88e-31 SMART
low complexity region 394 417 N/A INTRINSIC
AAA 505 656 1e-7 SMART
Cdc6_C 757 837 5.45e-12 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 100% (63/63)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The origin recognition complex (ORC) is a highly conserved six subunits protein complex essential for the initiation of the DNA replication in eukaryotic cells. Studies in yeast demonstrated that ORC binds specifically to origins of replication and serves as a platform for the assembly of additional initiation factors such as Cdc6 and Mcm proteins. The protein encoded by this gene is the largest subunit of the ORC complex. While other ORC subunits are stable throughout the cell cycle, the levels of this protein vary during the cell cycle, which has been shown to be controlled by ubiquitin-mediated proteolysis after initiation of DNA replication. This protein is found to be selectively phosphorylated during mitosis. It is also reported to interact with MYST histone acetyltransferase 2 (MyST2/HBO1), a protein involved in control of transcription silencing. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jun 2010]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcf3 C T 16: 20,548,680 T3I probably benign Het
Ahi1 T A 10: 20,987,077 V717E probably damaging Het
Anapc4 A G 5: 52,845,330 T238A probably damaging Het
Arhgap27 A T 11: 103,360,541 C120* probably null Het
Bdp1 A T 13: 100,041,532 V1943D probably damaging Het
Cdc14b A G 13: 64,225,647 V141A probably damaging Het
Cfap46 G T 7: 139,635,146 probably null Het
Cgnl1 C A 9: 71,725,883 R62L possibly damaging Het
Chaf1a A G 17: 56,062,573 S522G probably benign Het
Cox19 A G 5: 139,342,647 F37S probably damaging Het
Csmd1 G A 8: 16,058,707 S1894L probably damaging Het
Cyp4a12a A T 4: 115,327,559 R346W probably damaging Het
Dip2a A C 10: 76,272,562 C1315G probably benign Het
Dmxl2 A C 9: 54,401,585 W1961G probably damaging Het
Dst T C 1: 34,201,405 L1945P probably damaging Het
Efr3a A G 15: 65,819,778 S92G probably damaging Het
Ep300 C T 15: 81,627,314 T865I unknown Het
Ercc6 A G 14: 32,526,404 E304G probably benign Het
Filip1l A C 16: 57,570,937 E629D probably damaging Het
Frem1 G A 4: 83,020,755 T30I possibly damaging Het
Glb1 T C 9: 114,417,058 F59S probably benign Het
Gli3 T C 13: 15,725,559 L1177P probably benign Het
Gm16486 T A 8: 70,716,804 M1181K possibly damaging Het
Gpatch2l A G 12: 86,256,872 T223A probably damaging Het
Gpt2 G A 8: 85,518,052 E325K probably benign Het
Hmcn1 A T 1: 150,603,814 M4633K probably benign Het
Hoxc8 T A 15: 102,991,110 Y111N probably damaging Het
Ifi207 A G 1: 173,729,015 L726P probably benign Het
Iqgap2 T A 13: 95,635,655 M1339L probably benign Het
Kif21b A G 1: 136,159,649 Q901R possibly damaging Het
Krtap4-8 C A 11: 99,780,408 C79F unknown Het
Ldb3 T C 14: 34,571,802 N155S probably damaging Het
Mad2l1 T A 6: 66,539,810 V162E probably benign Het
Map7 T A 10: 20,233,462 V87E unknown Het
Mndal A T 1: 173,875,619 D73E unknown Het
Msantd1 T C 5: 34,917,695 S34P probably damaging Het
Myh14 T C 7: 44,611,553 Q1838R possibly damaging Het
Myh15 G T 16: 49,173,006 R1668L possibly damaging Het
Ncoa7 A G 10: 30,689,800 M666T probably damaging Het
Nol6 A T 4: 41,116,686 L944Q probably benign Het
Olfr197 A T 16: 59,186,013 F157I unknown Het
Pcp4l1 G A 1: 171,174,465 A42V possibly damaging Het
Pglyrp2 C T 17: 32,415,919 A490T probably benign Het
Pirb A T 7: 3,717,188 C395* probably null Het
Ppp1r11 T C 17: 36,951,008 R12G possibly damaging Het
Prlr A G 15: 10,346,438 D290G probably benign Het
Ptpn21 G T 12: 98,680,101 R1033S probably damaging Het
Rad54l2 A G 9: 106,693,461 L1220P possibly damaging Het
Rufy3 G A 5: 88,642,952 R504H probably damaging Het
Scgb2b21 C T 7: 33,519,905 V25I probably benign Het
Sh3bgrl2 T C 9: 83,548,489 S11P possibly damaging Het
Slain2 A T 5: 72,974,659 T498S probably benign Het
Slc12a4 C T 8: 105,955,715 G121S probably damaging Het
Slc30a9 A T 5: 67,342,119 I307F probably damaging Het
Snap91 C T 9: 86,773,545 G800R unknown Het
Tnc G T 4: 63,964,762 probably null Het
Trav21-dv12 T C 14: 53,876,057 probably benign Het
Txk A T 5: 72,715,883 I228N probably damaging Het
Vac14 T C 8: 110,711,620 Y622H probably damaging Het
Vmn2r111 T C 17: 22,559,051 N549S possibly damaging Het
Wdr35 T G 12: 8,987,312 M306R probably benign Het
Zan A T 5: 137,465,232 S562T probably benign Het
Other mutations in Orc1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00333:Orc1 APN 4 108595325 splice site probably benign
IGL00709:Orc1 APN 4 108590778 critical splice donor site probably null
IGL01124:Orc1 APN 4 108588787 splice site probably benign
IGL01514:Orc1 APN 4 108602052 missense probably damaging 0.97
IGL01677:Orc1 APN 4 108604585 missense probably damaging 1.00
IGL01782:Orc1 APN 4 108606268 missense possibly damaging 0.78
IGL01886:Orc1 APN 4 108603957 splice site probably null
IGL01912:Orc1 APN 4 108590744 missense probably damaging 1.00
IGL02057:Orc1 APN 4 108588729 missense possibly damaging 0.53
IGL02155:Orc1 APN 4 108590677 missense probably benign 0.00
IGL02311:Orc1 APN 4 108599974 missense probably benign
IGL02616:Orc1 APN 4 108595479 missense probably benign 0.00
land_lubber UTSW 4 108588687 start codon destroyed probably damaging 0.99
R0012:Orc1 UTSW 4 108595646 critical splice donor site probably null
R0195:Orc1 UTSW 4 108614308 nonsense probably null
R0239:Orc1 UTSW 4 108595646 critical splice donor site probably null
R0239:Orc1 UTSW 4 108595646 critical splice donor site probably null
R0611:Orc1 UTSW 4 108602032 missense probably benign
R1351:Orc1 UTSW 4 108595367 missense probably benign 0.01
R1966:Orc1 UTSW 4 108612217 missense probably damaging 1.00
R2018:Orc1 UTSW 4 108590700 missense possibly damaging 0.95
R2398:Orc1 UTSW 4 108601969 missense possibly damaging 0.68
R3110:Orc1 UTSW 4 108604560 missense probably benign 0.01
R3112:Orc1 UTSW 4 108604560 missense probably benign 0.01
R3712:Orc1 UTSW 4 108604021 missense probably damaging 1.00
R3716:Orc1 UTSW 4 108614459 missense probably damaging 1.00
R3829:Orc1 UTSW 4 108605631 missense probably damaging 1.00
R4282:Orc1 UTSW 4 108606274 missense probably benign 0.18
R4320:Orc1 UTSW 4 108588776 missense probably benign
R4321:Orc1 UTSW 4 108588776 missense probably benign
R4322:Orc1 UTSW 4 108588776 missense probably benign
R4348:Orc1 UTSW 4 108593452 missense probably damaging 0.98
R4562:Orc1 UTSW 4 108602055 critical splice donor site probably null
R4772:Orc1 UTSW 4 108579568 utr 5 prime probably benign
R4914:Orc1 UTSW 4 108604558 missense probably damaging 1.00
R4964:Orc1 UTSW 4 108614473 makesense probably null
R5219:Orc1 UTSW 4 108590769 missense probably damaging 1.00
R5428:Orc1 UTSW 4 108599940 missense probably benign 0.00
R5655:Orc1 UTSW 4 108593439 missense probably benign 0.09
R5693:Orc1 UTSW 4 108613079 missense probably benign 0.01
R5936:Orc1 UTSW 4 108601983 missense probably benign 0.10
R5960:Orc1 UTSW 4 108606298 missense possibly damaging 0.67
R6294:Orc1 UTSW 4 108590670 missense probably benign 0.01
R6504:Orc1 UTSW 4 108590717 missense probably benign 0.15
R6533:Orc1 UTSW 4 108597447 missense probably benign 0.05
R6775:Orc1 UTSW 4 108603455 missense probably damaging 1.00
R7123:Orc1 UTSW 4 108588687 start codon destroyed probably damaging 0.99
R7156:Orc1 UTSW 4 108595459 missense probably benign 0.00
R7552:Orc1 UTSW 4 108588754 missense probably benign 0.41
R7842:Orc1 UTSW 4 108605547 missense probably benign 0.00
R7925:Orc1 UTSW 4 108605547 missense probably benign 0.00
R7982:Orc1 UTSW 4 108603371 intron probably null
R8033:Orc1 UTSW 4 108605564 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGCCTAGTAGTAAGACTTTGTAGG -3'
(R):5'- AGGCTACATTTTGCATTCCAACTTC -3'

Sequencing Primer
(F):5'- GTCTACATAGTGAGTTCCAGGAC -3'
(R):5'- GGTCCCGAGTTCAAATCTCAG -3'
Posted On2019-09-13