Incidental Mutation 'R7327:Slc30a9'
ID568977
Institutional Source Beutler Lab
Gene Symbol Slc30a9
Ensembl Gene ENSMUSG00000029221
Gene Namesolute carrier family 30 (zinc transporter), member 9
Synonyms2310024J23Rik, GAC63
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.916) question?
Stock #R7327 (G1)
Quality Score225.009
Status Validated
Chromosome5
Chromosomal Location67306955-67358443 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 67342119 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 307 (I307F)
Ref Sequence ENSEMBL: ENSMUSP00000124047 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000113676] [ENSMUST00000162372] [ENSMUST00000202521]
Predicted Effect possibly damaging
Transcript: ENSMUST00000113676
AA Change: I287F

PolyPhen 2 Score 0.949 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000109306
Gene: ENSMUSG00000029221
AA Change: I287F

DomainStartEndE-ValueType
low complexity region 17 32 N/A INTRINSIC
PDB:2ENK|A 103 196 2e-54 PDB
SCOP:d1d4ua1 106 174 3e-28 SMART
Pfam:Cation_efflux 219 547 1.6e-41 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000162372
AA Change: I307F

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000124047
Gene: ENSMUSG00000029221
AA Change: I307F

DomainStartEndE-ValueType
low complexity region 17 32 N/A INTRINSIC
PDB:2ENK|A 123 216 2e-54 PDB
SCOP:d1d4ua1 126 194 5e-28 SMART
Pfam:Cation_efflux 239 449 1e-33 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000200734
Predicted Effect probably benign
Transcript: ENSMUST00000202521
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 100% (63/63)
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcf3 C T 16: 20,548,680 T3I probably benign Het
Ahi1 T A 10: 20,987,077 V717E probably damaging Het
Anapc4 A G 5: 52,845,330 T238A probably damaging Het
Arhgap27 A T 11: 103,360,541 C120* probably null Het
Bdp1 A T 13: 100,041,532 V1943D probably damaging Het
Cdc14b A G 13: 64,225,647 V141A probably damaging Het
Cfap46 G T 7: 139,635,146 probably null Het
Cgnl1 C A 9: 71,725,883 R62L possibly damaging Het
Chaf1a A G 17: 56,062,573 S522G probably benign Het
Cox19 A G 5: 139,342,647 F37S probably damaging Het
Csmd1 G A 8: 16,058,707 S1894L probably damaging Het
Cyp4a12a A T 4: 115,327,559 R346W probably damaging Het
Dip2a A C 10: 76,272,562 C1315G probably benign Het
Dmxl2 A C 9: 54,401,585 W1961G probably damaging Het
Dst T C 1: 34,201,405 L1945P probably damaging Het
Efr3a A G 15: 65,819,778 S92G probably damaging Het
Ep300 C T 15: 81,627,314 T865I unknown Het
Ercc6 A G 14: 32,526,404 E304G probably benign Het
Filip1l A C 16: 57,570,937 E629D probably damaging Het
Frem1 G A 4: 83,020,755 T30I possibly damaging Het
Glb1 T C 9: 114,417,058 F59S probably benign Het
Gli3 T C 13: 15,725,559 L1177P probably benign Het
Gm16486 T A 8: 70,716,804 M1181K possibly damaging Het
Gpatch2l A G 12: 86,256,872 T223A probably damaging Het
Gpt2 G A 8: 85,518,052 E325K probably benign Het
Hmcn1 A T 1: 150,603,814 M4633K probably benign Het
Hoxc8 T A 15: 102,991,110 Y111N probably damaging Het
Ifi207 A G 1: 173,729,015 L726P probably benign Het
Iqgap2 T A 13: 95,635,655 M1339L probably benign Het
Kif21b A G 1: 136,159,649 Q901R possibly damaging Het
Krtap4-8 C A 11: 99,780,408 C79F unknown Het
Ldb3 T C 14: 34,571,802 N155S probably damaging Het
Mad2l1 T A 6: 66,539,810 V162E probably benign Het
Map7 T A 10: 20,233,462 V87E unknown Het
Mndal A T 1: 173,875,619 D73E unknown Het
Msantd1 T C 5: 34,917,695 S34P probably damaging Het
Myh14 T C 7: 44,611,553 Q1838R possibly damaging Het
Myh15 G T 16: 49,173,006 R1668L possibly damaging Het
Ncoa7 A G 10: 30,689,800 M666T probably damaging Het
Nol6 A T 4: 41,116,686 L944Q probably benign Het
Olfr197 A T 16: 59,186,013 F157I unknown Het
Orc1 A G 4: 108,588,714 T10A probably benign Het
Pcp4l1 G A 1: 171,174,465 A42V possibly damaging Het
Pglyrp2 C T 17: 32,415,919 A490T probably benign Het
Pirb A T 7: 3,717,188 C395* probably null Het
Ppp1r11 T C 17: 36,951,008 R12G possibly damaging Het
Prlr A G 15: 10,346,438 D290G probably benign Het
Ptpn21 G T 12: 98,680,101 R1033S probably damaging Het
Rad54l2 A G 9: 106,693,461 L1220P possibly damaging Het
Rufy3 G A 5: 88,642,952 R504H probably damaging Het
Scgb2b21 C T 7: 33,519,905 V25I probably benign Het
Sh3bgrl2 T C 9: 83,548,489 S11P possibly damaging Het
Slain2 A T 5: 72,974,659 T498S probably benign Het
Slc12a4 C T 8: 105,955,715 G121S probably damaging Het
Snap91 C T 9: 86,773,545 G800R unknown Het
Tnc G T 4: 63,964,762 probably null Het
Trav21-dv12 T C 14: 53,876,057 probably benign Het
Txk A T 5: 72,715,883 I228N probably damaging Het
Vac14 T C 8: 110,711,620 Y622H probably damaging Het
Vmn2r111 T C 17: 22,559,051 N549S possibly damaging Het
Wdr35 T G 12: 8,987,312 M306R probably benign Het
Zan A T 5: 137,465,232 S562T probably benign Het
Other mutations in Slc30a9
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00792:Slc30a9 APN 5 67342109 missense probably damaging 1.00
IGL00975:Slc30a9 APN 5 67349826 missense probably damaging 1.00
IGL01129:Slc30a9 APN 5 67342143 missense probably damaging 1.00
IGL01377:Slc30a9 APN 5 67315830 missense probably benign
IGL01785:Slc30a9 APN 5 67346238 splice site probably benign
IGL01786:Slc30a9 APN 5 67346238 splice site probably benign
IGL02407:Slc30a9 APN 5 67352722 missense probably damaging 1.00
IGL03185:Slc30a9 APN 5 67333063 missense probably benign
IGL03276:Slc30a9 APN 5 67349917 splice site probably benign
IGL03380:Slc30a9 APN 5 67315711 missense probably benign 0.04
ANU74:Slc30a9 UTSW 5 67349852 missense probably damaging 1.00
R0539:Slc30a9 UTSW 5 67334610 missense probably damaging 1.00
R1401:Slc30a9 UTSW 5 67352662 missense probably benign
R1554:Slc30a9 UTSW 5 67326921 missense probably damaging 1.00
R1824:Slc30a9 UTSW 5 67348052 missense probably damaging 1.00
R2029:Slc30a9 UTSW 5 67339975 nonsense probably null
R4385:Slc30a9 UTSW 5 67315767 missense probably damaging 1.00
R4704:Slc30a9 UTSW 5 67342273 intron probably benign
R4868:Slc30a9 UTSW 5 67324683 missense probably benign
R4907:Slc30a9 UTSW 5 67346162 missense probably damaging 1.00
R5553:Slc30a9 UTSW 5 67345604 intron probably null
R6002:Slc30a9 UTSW 5 67342117 missense probably damaging 1.00
R6477:Slc30a9 UTSW 5 67328524 missense probably benign 0.01
R6718:Slc30a9 UTSW 5 67333100 missense probably damaging 1.00
R7113:Slc30a9 UTSW 5 67326862 missense probably benign 0.17
R7224:Slc30a9 UTSW 5 67315701 missense probably benign
R7394:Slc30a9 UTSW 5 67352766 critical splice donor site probably null
R7467:Slc30a9 UTSW 5 67345644 missense probably benign 0.08
R7514:Slc30a9 UTSW 5 67348078 missense possibly damaging 0.68
R8020:Slc30a9 UTSW 5 67307033 start gained probably benign
Z1176:Slc30a9 UTSW 5 67339958 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGAGCCAGCAGTAAGTTTCATG -3'
(R):5'- CCAAGAGGCAAATTATTTCTGTCCTC -3'

Sequencing Primer
(F):5'- GCCAGCAGTAAGTTTCATGTTAAAC -3'
(R):5'- CTGTCCTCTAATACAATATGGAAAGG -3'
Posted On2019-09-13