Incidental Mutation 'R7327:Cgnl1'
ID568993
Institutional Source Beutler Lab
Gene Symbol Cgnl1
Ensembl Gene ENSMUSG00000032232
Gene Namecingulin-like 1
SynonymsJacop, 9930020M10Rik, 4933421H10Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7327 (G1)
Quality Score225.009
Status Validated
Chromosome9
Chromosomal Location71626509-71771602 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 71725883 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Leucine at position 62 (R62L)
Ref Sequence ENSEMBL: ENSMUSP00000112479 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000072899] [ENSMUST00000121322] [ENSMUST00000122065]
Predicted Effect possibly damaging
Transcript: ENSMUST00000072899
AA Change: R62L

PolyPhen 2 Score 0.481 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000072672
Gene: ENSMUSG00000032232
AA Change: R62L

DomainStartEndE-ValueType
low complexity region 292 309 N/A INTRINSIC
low complexity region 539 550 N/A INTRINSIC
low complexity region 615 634 N/A INTRINSIC
low complexity region 638 653 N/A INTRINSIC
low complexity region 728 739 N/A INTRINSIC
Pfam:Myosin_tail_1 984 1255 5.4e-30 PFAM
low complexity region 1258 1278 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000121322
AA Change: R62L

PolyPhen 2 Score 0.795 (Sensitivity: 0.85; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000113917
Gene: ENSMUSG00000032232
AA Change: R62L

DomainStartEndE-ValueType
low complexity region 292 309 N/A INTRINSIC
low complexity region 539 550 N/A INTRINSIC
low complexity region 615 634 N/A INTRINSIC
low complexity region 638 653 N/A INTRINSIC
Pfam:Myosin_tail_1 909 1184 2.3e-30 PFAM
low complexity region 1187 1207 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000122065
AA Change: R62L

PolyPhen 2 Score 0.481 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000112479
Gene: ENSMUSG00000032232
AA Change: R62L

DomainStartEndE-ValueType
low complexity region 292 309 N/A INTRINSIC
low complexity region 539 550 N/A INTRINSIC
Pfam:Myosin_tail_1 582 1034 1.3e-12 PFAM
Pfam:Myosin_tail_1 1011 1253 7.7e-38 PFAM
low complexity region 1258 1278 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 100% (63/63)
MGI Phenotype FUNCTION: This gene encodes a protein localized to the tight junctions and adherens junctions in vertebrate epithelial cells. The encoded protein regulates the activity of Rho family GTPases during junction assembly and at confluence. At the adherens junctions, the encoded protein is part of a protein complex that links E-cadherin to the microtubule cytoskeleton. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, Jan 2015]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcf3 C T 16: 20,548,680 T3I probably benign Het
Ahi1 T A 10: 20,987,077 V717E probably damaging Het
Anapc4 A G 5: 52,845,330 T238A probably damaging Het
Arhgap27 A T 11: 103,360,541 C120* probably null Het
Bdp1 A T 13: 100,041,532 V1943D probably damaging Het
Cdc14b A G 13: 64,225,647 V141A probably damaging Het
Cfap46 G T 7: 139,635,146 probably null Het
Chaf1a A G 17: 56,062,573 S522G probably benign Het
Cox19 A G 5: 139,342,647 F37S probably damaging Het
Csmd1 G A 8: 16,058,707 S1894L probably damaging Het
Cyp4a12a A T 4: 115,327,559 R346W probably damaging Het
Dip2a A C 10: 76,272,562 C1315G probably benign Het
Dmxl2 A C 9: 54,401,585 W1961G probably damaging Het
Dst T C 1: 34,201,405 L1945P probably damaging Het
Efr3a A G 15: 65,819,778 S92G probably damaging Het
Ep300 C T 15: 81,627,314 T865I unknown Het
Ercc6 A G 14: 32,526,404 E304G probably benign Het
Filip1l A C 16: 57,570,937 E629D probably damaging Het
Frem1 G A 4: 83,020,755 T30I possibly damaging Het
Glb1 T C 9: 114,417,058 F59S probably benign Het
Gli3 T C 13: 15,725,559 L1177P probably benign Het
Gm16486 T A 8: 70,716,804 M1181K possibly damaging Het
Gpatch2l A G 12: 86,256,872 T223A probably damaging Het
Gpt2 G A 8: 85,518,052 E325K probably benign Het
Hmcn1 A T 1: 150,603,814 M4633K probably benign Het
Hoxc8 T A 15: 102,991,110 Y111N probably damaging Het
Ifi207 A G 1: 173,729,015 L726P probably benign Het
Iqgap2 T A 13: 95,635,655 M1339L probably benign Het
Kif21b A G 1: 136,159,649 Q901R possibly damaging Het
Krtap4-8 C A 11: 99,780,408 C79F unknown Het
Ldb3 T C 14: 34,571,802 N155S probably damaging Het
Mad2l1 T A 6: 66,539,810 V162E probably benign Het
Map7 T A 10: 20,233,462 V87E unknown Het
Mndal A T 1: 173,875,619 D73E unknown Het
Msantd1 T C 5: 34,917,695 S34P probably damaging Het
Myh14 T C 7: 44,611,553 Q1838R possibly damaging Het
Myh15 G T 16: 49,173,006 R1668L possibly damaging Het
Ncoa7 A G 10: 30,689,800 M666T probably damaging Het
Nol6 A T 4: 41,116,686 L944Q probably benign Het
Olfr197 A T 16: 59,186,013 F157I unknown Het
Orc1 A G 4: 108,588,714 T10A probably benign Het
Pcp4l1 G A 1: 171,174,465 A42V possibly damaging Het
Pglyrp2 C T 17: 32,415,919 A490T probably benign Het
Pirb A T 7: 3,717,188 C395* probably null Het
Ppp1r11 T C 17: 36,951,008 R12G possibly damaging Het
Prlr A G 15: 10,346,438 D290G probably benign Het
Ptpn21 G T 12: 98,680,101 R1033S probably damaging Het
Rad54l2 A G 9: 106,693,461 L1220P possibly damaging Het
Rufy3 G A 5: 88,642,952 R504H probably damaging Het
Scgb2b21 C T 7: 33,519,905 V25I probably benign Het
Sh3bgrl2 T C 9: 83,548,489 S11P possibly damaging Het
Slain2 A T 5: 72,974,659 T498S probably benign Het
Slc12a4 C T 8: 105,955,715 G121S probably damaging Het
Slc30a9 A T 5: 67,342,119 I307F probably damaging Het
Snap91 C T 9: 86,773,545 G800R unknown Het
Tnc G T 4: 63,964,762 probably null Het
Trav21-dv12 T C 14: 53,876,057 probably benign Het
Txk A T 5: 72,715,883 I228N probably damaging Het
Vac14 T C 8: 110,711,620 Y622H probably damaging Het
Vmn2r111 T C 17: 22,559,051 N549S possibly damaging Het
Wdr35 T G 12: 8,987,312 M306R probably benign Het
Zan A T 5: 137,465,232 S562T probably benign Het
Other mutations in Cgnl1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00556:Cgnl1 APN 9 71656056 missense probably benign 0.00
IGL01128:Cgnl1 APN 9 71724561 missense possibly damaging 0.81
IGL01450:Cgnl1 APN 9 71631862 splice site probably benign
IGL01788:Cgnl1 APN 9 71655390 missense probably benign
IGL01806:Cgnl1 APN 9 71650322 missense probably damaging 0.99
IGL01906:Cgnl1 APN 9 71724567 missense probably benign 0.00
IGL01933:Cgnl1 APN 9 71645483 splice site probably benign
IGL01939:Cgnl1 APN 9 71725004 missense probably damaging 1.00
IGL01947:Cgnl1 APN 9 71725044 missense probably damaging 0.99
IGL02127:Cgnl1 APN 9 71725853 missense probably damaging 1.00
IGL02379:Cgnl1 APN 9 71645553 missense possibly damaging 0.82
IGL02510:Cgnl1 APN 9 71725357 missense probably benign 0.41
FR4548:Cgnl1 UTSW 9 71724717 small insertion probably benign
R0058:Cgnl1 UTSW 9 71641397 missense probably damaging 1.00
R0058:Cgnl1 UTSW 9 71724840 missense probably damaging 0.99
R0105:Cgnl1 UTSW 9 71656102 missense probably benign
R0220:Cgnl1 UTSW 9 71724943 missense possibly damaging 0.68
R0242:Cgnl1 UTSW 9 71721657 missense probably damaging 1.00
R0401:Cgnl1 UTSW 9 71705239 missense probably damaging 1.00
R0541:Cgnl1 UTSW 9 71651253 missense possibly damaging 0.54
R1018:Cgnl1 UTSW 9 71726058 missense probably damaging 1.00
R1026:Cgnl1 UTSW 9 71717431 missense possibly damaging 0.91
R1056:Cgnl1 UTSW 9 71725895 missense probably damaging 1.00
R1299:Cgnl1 UTSW 9 71721712 splice site probably benign
R1513:Cgnl1 UTSW 9 71724590 missense probably benign 0.02
R1546:Cgnl1 UTSW 9 71725815 missense probably benign
R1599:Cgnl1 UTSW 9 71641427 missense probably benign 0.02
R1657:Cgnl1 UTSW 9 71725944 missense probably damaging 0.98
R1970:Cgnl1 UTSW 9 71725535 missense probably benign 0.10
R2004:Cgnl1 UTSW 9 71630539 missense probably damaging 1.00
R2080:Cgnl1 UTSW 9 71656096 missense probably benign 0.01
R2085:Cgnl1 UTSW 9 71630878 missense probably damaging 1.00
R2357:Cgnl1 UTSW 9 71725668 nonsense probably null
R2402:Cgnl1 UTSW 9 71725179 missense probably damaging 1.00
R3954:Cgnl1 UTSW 9 71724663 missense probably benign 0.01
R4043:Cgnl1 UTSW 9 71705293 missense probably damaging 1.00
R4127:Cgnl1 UTSW 9 71724540 missense probably benign 0.00
R4825:Cgnl1 UTSW 9 71630524 missense probably benign 0.00
R4851:Cgnl1 UTSW 9 71725032 missense probably damaging 1.00
R4882:Cgnl1 UTSW 9 71717401 missense probably benign 0.00
R4996:Cgnl1 UTSW 9 71724826 small deletion probably benign
R5057:Cgnl1 UTSW 9 71724794 missense probably damaging 0.99
R5263:Cgnl1 UTSW 9 71632654 nonsense probably null
R5402:Cgnl1 UTSW 9 71629321 missense probably damaging 1.00
R5744:Cgnl1 UTSW 9 71630675 intron probably null
R5770:Cgnl1 UTSW 9 71645487 splice site probably null
R6911:Cgnl1 UTSW 9 71656215 missense possibly damaging 0.82
R7014:Cgnl1 UTSW 9 71725134 missense possibly damaging 0.86
R7106:Cgnl1 UTSW 9 71725733 missense probably benign 0.00
R7203:Cgnl1 UTSW 9 71724533 missense possibly damaging 0.80
R7231:Cgnl1 UTSW 9 71632645 missense probably benign 0.39
R7241:Cgnl1 UTSW 9 71724770 missense probably benign
R7288:Cgnl1 UTSW 9 71725564 missense possibly damaging 0.67
R7390:Cgnl1 UTSW 9 71645649 missense probably benign 0.04
R7529:Cgnl1 UTSW 9 71631758 missense probably damaging 1.00
R7793:Cgnl1 UTSW 9 71725635 missense probably damaging 1.00
RF015:Cgnl1 UTSW 9 71724715 small insertion probably benign
RF042:Cgnl1 UTSW 9 71724715 small insertion probably benign
Predicted Primers PCR Primer
(F):5'- TCTGGAAGTTGAGCACATGG -3'
(R):5'- TGGCGAATACCAACACGTACAG -3'

Sequencing Primer
(F):5'- AGGGAGAACTGCTTCTGGC -3'
(R):5'- GCAGGAGTACGGGGTACACC -3'
Posted On2019-09-13