Incidental Mutation 'R7327:Ptpn21'
ID569006
Institutional Source Beutler Lab
Gene Symbol Ptpn21
Ensembl Gene ENSMUSG00000021009
Gene Nameprotein tyrosine phosphatase, non-receptor type 21
SynonymsPTPD1, PTPRL10
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.153) question?
Stock #R7327 (G1)
Quality Score225.009
Status Validated
Chromosome12
Chromosomal Location98676741-98737405 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 98680101 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Serine at position 1033 (R1033S)
Ref Sequence ENSEMBL: ENSMUSP00000082197 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000085116] [ENSMUST00000170188] [ENSMUST00000221148] [ENSMUST00000221535] [ENSMUST00000221932]
Predicted Effect probably damaging
Transcript: ENSMUST00000085116
AA Change: R1033S

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000082197
Gene: ENSMUSG00000021009
AA Change: R1033S

DomainStartEndE-ValueType
B41 19 222 5.04e-69 SMART
FERM_C 226 312 4.66e-26 SMART
low complexity region 332 343 N/A INTRINSIC
low complexity region 563 574 N/A INTRINSIC
low complexity region 710 724 N/A INTRINSIC
PTPc 897 1171 7.31e-111 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000170188
AA Change: R1033S

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000126975
Gene: ENSMUSG00000021009
AA Change: R1033S

DomainStartEndE-ValueType
B41 19 222 5.04e-69 SMART
FERM_C 226 312 4.66e-26 SMART
low complexity region 332 343 N/A INTRINSIC
low complexity region 563 574 N/A INTRINSIC
low complexity region 710 724 N/A INTRINSIC
PTPc 897 1171 7.31e-111 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000221148
Predicted Effect probably benign
Transcript: ENSMUST00000221535
Predicted Effect probably benign
Transcript: ENSMUST00000221932
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 100% (63/63)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the protein tyrosine phosphatase (PTP) family. PTPs are known to be signaling molecules that regulate a variety of cellular processes including cell growth, differentiation, mitotic cycle, and oncogenic transformation. This PTP contains an N-terminal domain, similar to cytoskeletal- associated proteins including band 4.1, ezrin, merlin, and radixin. This PTP was shown to specially interact with BMX/ETK, a member of Tec tyrosine kinase family characterized by a multimodular structures including PH, SH3, and SH2 domains. The interaction of this PTP with BMX kinase was found to increase the activation of STAT3, but not STAT2 kinase. Studies of the similar gene in mice suggested the possible roles of this PTP in liver regeneration and spermatogenesis. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcf3 C T 16: 20,548,680 T3I probably benign Het
Ahi1 T A 10: 20,987,077 V717E probably damaging Het
Anapc4 A G 5: 52,845,330 T238A probably damaging Het
Arhgap27 A T 11: 103,360,541 C120* probably null Het
Bdp1 A T 13: 100,041,532 V1943D probably damaging Het
Cdc14b A G 13: 64,225,647 V141A probably damaging Het
Cfap46 G T 7: 139,635,146 probably null Het
Cgnl1 C A 9: 71,725,883 R62L possibly damaging Het
Chaf1a A G 17: 56,062,573 S522G probably benign Het
Cox19 A G 5: 139,342,647 F37S probably damaging Het
Csmd1 G A 8: 16,058,707 S1894L probably damaging Het
Cyp4a12a A T 4: 115,327,559 R346W probably damaging Het
Dip2a A C 10: 76,272,562 C1315G probably benign Het
Dmxl2 A C 9: 54,401,585 W1961G probably damaging Het
Dst T C 1: 34,201,405 L1945P probably damaging Het
Efr3a A G 15: 65,819,778 S92G probably damaging Het
Ep300 C T 15: 81,627,314 T865I unknown Het
Ercc6 A G 14: 32,526,404 E304G probably benign Het
Filip1l A C 16: 57,570,937 E629D probably damaging Het
Frem1 G A 4: 83,020,755 T30I possibly damaging Het
Glb1 T C 9: 114,417,058 F59S probably benign Het
Gli3 T C 13: 15,725,559 L1177P probably benign Het
Gm16486 T A 8: 70,716,804 M1181K possibly damaging Het
Gpatch2l A G 12: 86,256,872 T223A probably damaging Het
Gpt2 G A 8: 85,518,052 E325K probably benign Het
Hmcn1 A T 1: 150,603,814 M4633K probably benign Het
Hoxc8 T A 15: 102,991,110 Y111N probably damaging Het
Ifi207 A G 1: 173,729,015 L726P probably benign Het
Iqgap2 T A 13: 95,635,655 M1339L probably benign Het
Kif21b A G 1: 136,159,649 Q901R possibly damaging Het
Krtap4-8 C A 11: 99,780,408 C79F unknown Het
Ldb3 T C 14: 34,571,802 N155S probably damaging Het
Mad2l1 T A 6: 66,539,810 V162E probably benign Het
Map7 T A 10: 20,233,462 V87E unknown Het
Mndal A T 1: 173,875,619 D73E unknown Het
Msantd1 T C 5: 34,917,695 S34P probably damaging Het
Myh14 T C 7: 44,611,553 Q1838R possibly damaging Het
Myh15 G T 16: 49,173,006 R1668L possibly damaging Het
Ncoa7 A G 10: 30,689,800 M666T probably damaging Het
Nol6 A T 4: 41,116,686 L944Q probably benign Het
Olfr197 A T 16: 59,186,013 F157I unknown Het
Orc1 A G 4: 108,588,714 T10A probably benign Het
Pcp4l1 G A 1: 171,174,465 A42V possibly damaging Het
Pglyrp2 C T 17: 32,415,919 A490T probably benign Het
Pirb A T 7: 3,717,188 C395* probably null Het
Ppp1r11 T C 17: 36,951,008 R12G possibly damaging Het
Prlr A G 15: 10,346,438 D290G probably benign Het
Rad54l2 A G 9: 106,693,461 L1220P possibly damaging Het
Rufy3 G A 5: 88,642,952 R504H probably damaging Het
Scgb2b21 C T 7: 33,519,905 V25I probably benign Het
Sh3bgrl2 T C 9: 83,548,489 S11P possibly damaging Het
Slain2 A T 5: 72,974,659 T498S probably benign Het
Slc12a4 C T 8: 105,955,715 G121S probably damaging Het
Slc30a9 A T 5: 67,342,119 I307F probably damaging Het
Snap91 C T 9: 86,773,545 G800R unknown Het
Tnc G T 4: 63,964,762 probably null Het
Trav21-dv12 T C 14: 53,876,057 probably benign Het
Txk A T 5: 72,715,883 I228N probably damaging Het
Vac14 T C 8: 110,711,620 Y622H probably damaging Het
Vmn2r111 T C 17: 22,559,051 N549S possibly damaging Het
Wdr35 T G 12: 8,987,312 M306R probably benign Het
Zan A T 5: 137,465,232 S562T probably benign Het
Other mutations in Ptpn21
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00093:Ptpn21 APN 12 98680468 missense probably damaging 1.00
IGL00576:Ptpn21 APN 12 98733601 missense probably damaging 1.00
IGL00577:Ptpn21 APN 12 98733601 missense probably damaging 1.00
IGL00580:Ptpn21 APN 12 98733601 missense probably damaging 1.00
IGL00583:Ptpn21 APN 12 98733601 missense probably damaging 1.00
IGL00773:Ptpn21 APN 12 98688313 missense probably benign 0.00
IGL00780:Ptpn21 APN 12 98680371 missense probably damaging 1.00
IGL01516:Ptpn21 APN 12 98715189 missense probably damaging 1.00
IGL01616:Ptpn21 APN 12 98680013 missense probably damaging 1.00
IGL01939:Ptpn21 APN 12 98689161 missense probably damaging 0.96
IGL02237:Ptpn21 APN 12 98705092 critical splice donor site probably null
IGL02512:Ptpn21 APN 12 98679392 missense probably benign 0.00
IGL02852:Ptpn21 APN 12 98715195 critical splice acceptor site probably null
IGL02894:Ptpn21 APN 12 98689632 splice site probably benign
IGL03024:Ptpn21 APN 12 98680056 missense probably benign
IGL03220:Ptpn21 APN 12 98678623 missense probably damaging 1.00
R0144:Ptpn21 UTSW 12 98688609 missense probably benign 0.01
R0472:Ptpn21 UTSW 12 98704240 splice site probably benign
R0675:Ptpn21 UTSW 12 98688216 missense probably benign 0.16
R0771:Ptpn21 UTSW 12 98689080 missense probably damaging 1.00
R1434:Ptpn21 UTSW 12 98688590 missense probably damaging 1.00
R1470:Ptpn21 UTSW 12 98688476 missense probably benign
R1470:Ptpn21 UTSW 12 98688476 missense probably benign
R1837:Ptpn21 UTSW 12 98733626 missense probably damaging 0.99
R1897:Ptpn21 UTSW 12 98680405 unclassified probably null
R2048:Ptpn21 UTSW 12 98689526 missense possibly damaging 0.94
R2376:Ptpn21 UTSW 12 98688314 missense possibly damaging 0.62
R3709:Ptpn21 UTSW 12 98688541 missense probably benign
R4197:Ptpn21 UTSW 12 98680138 missense probably damaging 1.00
R4283:Ptpn21 UTSW 12 98733475 missense probably damaging 0.99
R4368:Ptpn21 UTSW 12 98678593 missense probably damaging 1.00
R4397:Ptpn21 UTSW 12 98688248 missense probably damaging 1.00
R4397:Ptpn21 UTSW 12 98715060 missense probably damaging 0.98
R4703:Ptpn21 UTSW 12 98679392 missense probably benign 0.00
R4737:Ptpn21 UTSW 12 98708844 missense probably benign 0.03
R4829:Ptpn21 UTSW 12 98689296 missense probably damaging 1.00
R4926:Ptpn21 UTSW 12 98715195 critical splice acceptor site probably null
R4974:Ptpn21 UTSW 12 98680103 missense probably damaging 1.00
R5022:Ptpn21 UTSW 12 98679407 missense probably damaging 1.00
R5057:Ptpn21 UTSW 12 98679407 missense probably damaging 1.00
R5395:Ptpn21 UTSW 12 98715117 missense probably damaging 1.00
R5608:Ptpn21 UTSW 12 98688777 missense probably benign 0.00
R5741:Ptpn21 UTSW 12 98679289 missense probably damaging 1.00
R5785:Ptpn21 UTSW 12 98682550 missense probably damaging 0.99
R5959:Ptpn21 UTSW 12 98708889 splice site probably null
R5968:Ptpn21 UTSW 12 98710890 missense probably damaging 1.00
R5984:Ptpn21 UTSW 12 98689076 missense probably damaging 1.00
R6005:Ptpn21 UTSW 12 98678552 makesense probably null
R6181:Ptpn21 UTSW 12 98699999 missense probably damaging 0.99
R6226:Ptpn21 UTSW 12 98680116 missense probably benign 0.24
R6226:Ptpn21 UTSW 12 98715172 missense probably damaging 1.00
R6317:Ptpn21 UTSW 12 98689262 missense probably damaging 1.00
R6370:Ptpn21 UTSW 12 98689034 missense possibly damaging 0.86
R6485:Ptpn21 UTSW 12 98698872 nonsense probably null
R6894:Ptpn21 UTSW 12 98715181 missense probably damaging 1.00
R7122:Ptpn21 UTSW 12 98688912 missense probably damaging 0.99
R7232:Ptpn21 UTSW 12 98688737 missense probably benign 0.17
R7289:Ptpn21 UTSW 12 98704191 missense probably benign 0.35
R7474:Ptpn21 UTSW 12 98737363 critical splice donor site probably null
R7748:Ptpn21 UTSW 12 98688772 missense probably benign 0.01
R7816:Ptpn21 UTSW 12 98682532 missense probably damaging 1.00
R7867:Ptpn21 UTSW 12 98705176 missense probably damaging 1.00
R7878:Ptpn21 UTSW 12 98715128 missense probably damaging 1.00
R7911:Ptpn21 UTSW 12 98688842 missense probably damaging 0.99
R7950:Ptpn21 UTSW 12 98705176 missense probably damaging 1.00
R7961:Ptpn21 UTSW 12 98715128 missense probably damaging 1.00
R7992:Ptpn21 UTSW 12 98688842 missense probably damaging 0.99
Z1177:Ptpn21 UTSW 12 98688458 missense not run
Predicted Primers PCR Primer
(F):5'- TCCAAAGGAAGCTGCCTATAAA -3'
(R):5'- CTCCAGAGAGCTGCTAAGGTTAA -3'

Sequencing Primer
(F):5'- GGAAGCTGCCTATAAACAAAGAC -3'
(R):5'- GCACCCAGAGTTAATCTTTAGTGAG -3'
Posted On2019-09-13