Incidental Mutation 'R7327:Ercc6'
ID569011
Institutional Source Beutler Lab
Gene Symbol Ercc6
Ensembl Gene ENSMUSG00000054051
Gene Nameexcision repair cross-complementing rodent repair deficiency, complementation group 6
SynonymsCS group B correcting gene, C130058G22Rik, CSB
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.282) question?
Stock #R7327 (G1)
Quality Score225.009
Status Validated
Chromosome14
Chromosomal Location32513521-32580990 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 32526404 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 304 (E304G)
Ref Sequence ENSEMBL: ENSMUSP00000066256 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000066807]
Predicted Effect probably benign
Transcript: ENSMUST00000066807
AA Change: E304G

PolyPhen 2 Score 0.185 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000066256
Gene: ENSMUSG00000054051
AA Change: E304G

DomainStartEndE-ValueType
PDB:4CVO|A 82 160 1e-36 PDB
low complexity region 286 299 N/A INTRINSIC
low complexity region 361 390 N/A INTRINSIC
low complexity region 422 434 N/A INTRINSIC
low complexity region 460 469 N/A INTRINSIC
low complexity region 479 491 N/A INTRINSIC
DEXDc 499 699 8.34e-33 SMART
Blast:DEXDc 720 821 7e-56 BLAST
HELICc 865 948 1.41e-21 SMART
low complexity region 1364 1377 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 100% (63/63)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a DNA-binding protein that is important in transcription-coupled excision repair. The encoded protein has ATP-stimulated ATPase activity, interacts with several transcription and excision repair proteins, and may promote complex formation at DNA repair sites. Mutations in this gene are associated with Cockayne syndrome type B and cerebrooculofacioskeletal syndrome 1. Alternative splicing occurs between a splice site from exon 5 of this gene to the 3' splice site upstream of the open reading frame (ORF) of the adjacent gene, piggyback-derived-3 (GeneID:267004), which activates the alternative polyadenylation site downstream of the piggyback-derived-3 ORF. The resulting transcripts encode a fusion protein that shares sequence with the product of each individual gene. [provided by RefSeq, Mar 2016]
PHENOTYPE: Homozygous mutant mice exhibit UV sensitivity, inactivation of transcription-coupled repair, increased incidence of induced skin and eye tumors, circling behavior, impaired coordination and lower body weight. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcf3 C T 16: 20,548,680 T3I probably benign Het
Ahi1 T A 10: 20,987,077 V717E probably damaging Het
Anapc4 A G 5: 52,845,330 T238A probably damaging Het
Arhgap27 A T 11: 103,360,541 C120* probably null Het
Bdp1 A T 13: 100,041,532 V1943D probably damaging Het
Cdc14b A G 13: 64,225,647 V141A probably damaging Het
Cfap46 G T 7: 139,635,146 probably null Het
Cgnl1 C A 9: 71,725,883 R62L possibly damaging Het
Chaf1a A G 17: 56,062,573 S522G probably benign Het
Cox19 A G 5: 139,342,647 F37S probably damaging Het
Csmd1 G A 8: 16,058,707 S1894L probably damaging Het
Cyp4a12a A T 4: 115,327,559 R346W probably damaging Het
Dip2a A C 10: 76,272,562 C1315G probably benign Het
Dmxl2 A C 9: 54,401,585 W1961G probably damaging Het
Dst T C 1: 34,201,405 L1945P probably damaging Het
Efr3a A G 15: 65,819,778 S92G probably damaging Het
Ep300 C T 15: 81,627,314 T865I unknown Het
Filip1l A C 16: 57,570,937 E629D probably damaging Het
Frem1 G A 4: 83,020,755 T30I possibly damaging Het
Glb1 T C 9: 114,417,058 F59S probably benign Het
Gli3 T C 13: 15,725,559 L1177P probably benign Het
Gm16486 T A 8: 70,716,804 M1181K possibly damaging Het
Gpatch2l A G 12: 86,256,872 T223A probably damaging Het
Gpt2 G A 8: 85,518,052 E325K probably benign Het
Hmcn1 A T 1: 150,603,814 M4633K probably benign Het
Hoxc8 T A 15: 102,991,110 Y111N probably damaging Het
Ifi207 A G 1: 173,729,015 L726P probably benign Het
Iqgap2 T A 13: 95,635,655 M1339L probably benign Het
Kif21b A G 1: 136,159,649 Q901R possibly damaging Het
Krtap4-8 C A 11: 99,780,408 C79F unknown Het
Ldb3 T C 14: 34,571,802 N155S probably damaging Het
Mad2l1 T A 6: 66,539,810 V162E probably benign Het
Map7 T A 10: 20,233,462 V87E unknown Het
Mndal A T 1: 173,875,619 D73E unknown Het
Msantd1 T C 5: 34,917,695 S34P probably damaging Het
Myh14 T C 7: 44,611,553 Q1838R possibly damaging Het
Myh15 G T 16: 49,173,006 R1668L possibly damaging Het
Ncoa7 A G 10: 30,689,800 M666T probably damaging Het
Nol6 A T 4: 41,116,686 L944Q probably benign Het
Olfr197 A T 16: 59,186,013 F157I unknown Het
Orc1 A G 4: 108,588,714 T10A probably benign Het
Pcp4l1 G A 1: 171,174,465 A42V possibly damaging Het
Pglyrp2 C T 17: 32,415,919 A490T probably benign Het
Pirb A T 7: 3,717,188 C395* probably null Het
Ppp1r11 T C 17: 36,951,008 R12G possibly damaging Het
Prlr A G 15: 10,346,438 D290G probably benign Het
Ptpn21 G T 12: 98,680,101 R1033S probably damaging Het
Rad54l2 A G 9: 106,693,461 L1220P possibly damaging Het
Rufy3 G A 5: 88,642,952 R504H probably damaging Het
Scgb2b21 C T 7: 33,519,905 V25I probably benign Het
Sh3bgrl2 T C 9: 83,548,489 S11P possibly damaging Het
Slain2 A T 5: 72,974,659 T498S probably benign Het
Slc12a4 C T 8: 105,955,715 G121S probably damaging Het
Slc30a9 A T 5: 67,342,119 I307F probably damaging Het
Snap91 C T 9: 86,773,545 G800R unknown Het
Tnc G T 4: 63,964,762 probably null Het
Trav21-dv12 T C 14: 53,876,057 probably benign Het
Txk A T 5: 72,715,883 I228N probably damaging Het
Vac14 T C 8: 110,711,620 Y622H probably damaging Het
Vmn2r111 T C 17: 22,559,051 N549S possibly damaging Het
Wdr35 T G 12: 8,987,312 M306R probably benign Het
Zan A T 5: 137,465,232 S562T probably benign Het
Other mutations in Ercc6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00321:Ercc6 APN 14 32568072 missense probably damaging 1.00
IGL00796:Ercc6 APN 14 32570002 missense probably benign 0.01
IGL00916:Ercc6 APN 14 32562655 intron probably benign
IGL01743:Ercc6 APN 14 32552604 missense probably damaging 1.00
IGL01802:Ercc6 APN 14 32562574 missense probably damaging 0.99
IGL01886:Ercc6 APN 14 32569580 missense possibly damaging 0.90
IGL02100:Ercc6 APN 14 32517095 missense probably benign 0.00
IGL02115:Ercc6 APN 14 32576993 missense probably damaging 1.00
IGL02755:Ercc6 APN 14 32575748 splice site probably benign
IGL02964:Ercc6 APN 14 32570103 missense probably benign 0.00
IGL02998:Ercc6 APN 14 32557857 missense probably benign 0.05
IGL03150:Ercc6 APN 14 32558574 missense probably damaging 0.96
R0152:Ercc6 UTSW 14 32546905 critical splice donor site probably benign
R0519:Ercc6 UTSW 14 32526842 missense probably damaging 1.00
R0591:Ercc6 UTSW 14 32558016 splice site probably benign
R0894:Ercc6 UTSW 14 32517028 missense probably benign 0.05
R0946:Ercc6 UTSW 14 32552621 missense probably benign 0.08
R1313:Ercc6 UTSW 14 32552720 splice site probably benign
R1506:Ercc6 UTSW 14 32569864 missense probably benign 0.01
R1528:Ercc6 UTSW 14 32519022 missense probably damaging 0.98
R1711:Ercc6 UTSW 14 32526176 missense probably damaging 1.00
R1753:Ercc6 UTSW 14 32576999 missense probably benign
R1795:Ercc6 UTSW 14 32517028 missense probably benign 0.05
R1843:Ercc6 UTSW 14 32546820 missense probably damaging 0.99
R1853:Ercc6 UTSW 14 32576816 missense possibly damaging 0.86
R1859:Ercc6 UTSW 14 32526778 missense probably damaging 1.00
R1912:Ercc6 UTSW 14 32576803 missense probably damaging 1.00
R2308:Ercc6 UTSW 14 32566409 missense possibly damaging 0.70
R2322:Ercc6 UTSW 14 32526317 missense probably damaging 1.00
R2386:Ercc6 UTSW 14 32541359 splice site probably null
R4170:Ercc6 UTSW 14 32566797 missense probably damaging 1.00
R4369:Ercc6 UTSW 14 32517207 missense probably damaging 0.96
R4389:Ercc6 UTSW 14 32574908 nonsense probably null
R4747:Ercc6 UTSW 14 32569907 missense probably benign 0.00
R4811:Ercc6 UTSW 14 32574929 missense probably benign 0.20
R4840:Ercc6 UTSW 14 32541296 missense probably damaging 1.00
R4973:Ercc6 UTSW 14 32574902 missense probably damaging 1.00
R5068:Ercc6 UTSW 14 32570063 missense probably benign 0.01
R5069:Ercc6 UTSW 14 32570063 missense probably benign 0.01
R5070:Ercc6 UTSW 14 32570063 missense probably benign 0.01
R5093:Ercc6 UTSW 14 32567522 missense probably damaging 1.00
R5265:Ercc6 UTSW 14 32569623 missense probably benign 0.01
R5272:Ercc6 UTSW 14 32519028 nonsense probably null
R5499:Ercc6 UTSW 14 32516959 start codon destroyed probably null 0.98
R5795:Ercc6 UTSW 14 32526352 missense probably damaging 0.98
R6258:Ercc6 UTSW 14 32557856 missense probably benign 0.00
R6260:Ercc6 UTSW 14 32557856 missense probably benign 0.00
R6267:Ercc6 UTSW 14 32526403 nonsense probably null
R6291:Ercc6 UTSW 14 32569986 missense probably benign 0.01
R6296:Ercc6 UTSW 14 32526403 nonsense probably null
R6361:Ercc6 UTSW 14 32517110 missense probably benign 0.00
R6500:Ercc6 UTSW 14 32526823 missense probably damaging 0.96
R6555:Ercc6 UTSW 14 32517107 missense probably benign 0.15
R6724:Ercc6 UTSW 14 32566331 missense probably benign 0.01
R6925:Ercc6 UTSW 14 32562608 missense probably damaging 0.99
R7143:Ercc6 UTSW 14 32570305 missense probably damaging 1.00
R7396:Ercc6 UTSW 14 32569805 missense probably benign 0.00
R7529:Ercc6 UTSW 14 32560729 nonsense probably null
R7609:Ercc6 UTSW 14 32566361 missense probably benign 0.11
Predicted Primers PCR Primer
(F):5'- TGGCCAGATGACACCGTTTG -3'
(R):5'- TCAGAAGACAGGCTGGCTAC -3'

Sequencing Primer
(F):5'- CGTTTGGTACCCCAGCC -3'
(R):5'- ACAGGCTGGCTACCCCTTC -3'
Posted On2019-09-13