Incidental Mutation 'R7327:Abcf3'
ID569018
Institutional Source Beutler Lab
Gene Symbol Abcf3
Ensembl Gene ENSMUSG00000003234
Gene NameATP-binding cassette, sub-family F (GCN20), member 3
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.113) question?
Stock #R7327 (G1)
Quality Score225.009
Status Validated
Chromosome16
Chromosomal Location20548577-20561379 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 20548680 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Isoleucine at position 3 (T3I)
Ref Sequence ENSEMBL: ENSMUSP00000003319 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000003319] [ENSMUST00000007216] [ENSMUST00000090023] [ENSMUST00000232490] [ENSMUST00000232680]
Predicted Effect probably benign
Transcript: ENSMUST00000003319
AA Change: T3I

PolyPhen 2 Score 0.028 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000003319
Gene: ENSMUSG00000003234
AA Change: T3I

DomainStartEndE-ValueType
low complexity region 120 137 N/A INTRINSIC
AAA 202 401 3.23e-11 SMART
low complexity region 423 435 N/A INTRINSIC
low complexity region 457 469 N/A INTRINSIC
AAA 517 684 4.68e-8 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000007216
SMART Domains Protein: ENSMUSP00000007216
Gene: ENSMUSG00000022841

DomainStartEndE-ValueType
Pfam:Clat_adaptor_s 1 137 6.7e-8 PFAM
Pfam:Adap_comp_sub 159 435 3.2e-84 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000090023
SMART Domains Protein: ENSMUSP00000087477
Gene: ENSMUSG00000022841

DomainStartEndE-ValueType
Pfam:Clat_adaptor_s 1 137 4.2e-8 PFAM
Pfam:Adap_comp_sub 157 433 8.7e-87 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000231258
Predicted Effect possibly damaging
Transcript: ENSMUST00000232490
AA Change: T2I

PolyPhen 2 Score 0.937 (Sensitivity: 0.80; Specificity: 0.94)
Predicted Effect probably benign
Transcript: ENSMUST00000232680
AA Change: T3I

PolyPhen 2 Score 0.047 (Sensitivity: 0.94; Specificity: 0.83)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 100% (63/63)
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ahi1 T A 10: 20,987,077 V717E probably damaging Het
Anapc4 A G 5: 52,845,330 T238A probably damaging Het
Arhgap27 A T 11: 103,360,541 C120* probably null Het
Bdp1 A T 13: 100,041,532 V1943D probably damaging Het
Cdc14b A G 13: 64,225,647 V141A probably damaging Het
Cfap46 G T 7: 139,635,146 probably null Het
Cgnl1 C A 9: 71,725,883 R62L possibly damaging Het
Chaf1a A G 17: 56,062,573 S522G probably benign Het
Cox19 A G 5: 139,342,647 F37S probably damaging Het
Csmd1 G A 8: 16,058,707 S1894L probably damaging Het
Cyp4a12a A T 4: 115,327,559 R346W probably damaging Het
Dip2a A C 10: 76,272,562 C1315G probably benign Het
Dmxl2 A C 9: 54,401,585 W1961G probably damaging Het
Dst T C 1: 34,201,405 L1945P probably damaging Het
Efr3a A G 15: 65,819,778 S92G probably damaging Het
Ep300 C T 15: 81,627,314 T865I unknown Het
Ercc6 A G 14: 32,526,404 E304G probably benign Het
Filip1l A C 16: 57,570,937 E629D probably damaging Het
Frem1 G A 4: 83,020,755 T30I possibly damaging Het
Glb1 T C 9: 114,417,058 F59S probably benign Het
Gli3 T C 13: 15,725,559 L1177P probably benign Het
Gm16486 T A 8: 70,716,804 M1181K possibly damaging Het
Gpatch2l A G 12: 86,256,872 T223A probably damaging Het
Gpt2 G A 8: 85,518,052 E325K probably benign Het
Hmcn1 A T 1: 150,603,814 M4633K probably benign Het
Hoxc8 T A 15: 102,991,110 Y111N probably damaging Het
Ifi207 A G 1: 173,729,015 L726P probably benign Het
Iqgap2 T A 13: 95,635,655 M1339L probably benign Het
Kif21b A G 1: 136,159,649 Q901R possibly damaging Het
Krtap4-8 C A 11: 99,780,408 C79F unknown Het
Ldb3 T C 14: 34,571,802 N155S probably damaging Het
Mad2l1 T A 6: 66,539,810 V162E probably benign Het
Map7 T A 10: 20,233,462 V87E unknown Het
Mndal A T 1: 173,875,619 D73E unknown Het
Msantd1 T C 5: 34,917,695 S34P probably damaging Het
Myh14 T C 7: 44,611,553 Q1838R possibly damaging Het
Myh15 G T 16: 49,173,006 R1668L possibly damaging Het
Ncoa7 A G 10: 30,689,800 M666T probably damaging Het
Nol6 A T 4: 41,116,686 L944Q probably benign Het
Olfr197 A T 16: 59,186,013 F157I unknown Het
Orc1 A G 4: 108,588,714 T10A probably benign Het
Pcp4l1 G A 1: 171,174,465 A42V possibly damaging Het
Pglyrp2 C T 17: 32,415,919 A490T probably benign Het
Pirb A T 7: 3,717,188 C395* probably null Het
Ppp1r11 T C 17: 36,951,008 R12G possibly damaging Het
Prlr A G 15: 10,346,438 D290G probably benign Het
Ptpn21 G T 12: 98,680,101 R1033S probably damaging Het
Rad54l2 A G 9: 106,693,461 L1220P possibly damaging Het
Rufy3 G A 5: 88,642,952 R504H probably damaging Het
Scgb2b21 C T 7: 33,519,905 V25I probably benign Het
Sh3bgrl2 T C 9: 83,548,489 S11P possibly damaging Het
Slain2 A T 5: 72,974,659 T498S probably benign Het
Slc12a4 C T 8: 105,955,715 G121S probably damaging Het
Slc30a9 A T 5: 67,342,119 I307F probably damaging Het
Snap91 C T 9: 86,773,545 G800R unknown Het
Tnc G T 4: 63,964,762 probably null Het
Trav21-dv12 T C 14: 53,876,057 probably benign Het
Txk A T 5: 72,715,883 I228N probably damaging Het
Vac14 T C 8: 110,711,620 Y622H probably damaging Het
Vmn2r111 T C 17: 22,559,051 N549S possibly damaging Het
Wdr35 T G 12: 8,987,312 M306R probably benign Het
Zan A T 5: 137,465,232 S562T probably benign Het
Other mutations in Abcf3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00972:Abcf3 APN 16 20551684 missense probably damaging 0.98
IGL01570:Abcf3 APN 16 20559998 missense probably damaging 1.00
IGL02239:Abcf3 APN 16 20550636 missense possibly damaging 0.85
R0158:Abcf3 UTSW 16 20552566 missense probably damaging 1.00
R0270:Abcf3 UTSW 16 20560168 splice site probably null
R0579:Abcf3 UTSW 16 20550648 missense probably benign
R0671:Abcf3 UTSW 16 20550487 missense probably damaging 1.00
R0799:Abcf3 UTSW 16 20559334 missense probably damaging 1.00
R1384:Abcf3 UTSW 16 20559303 missense probably damaging 1.00
R1393:Abcf3 UTSW 16 20560430 missense probably benign 0.01
R2356:Abcf3 UTSW 16 20560499 missense probably benign 0.01
R2910:Abcf3 UTSW 16 20560232 missense probably damaging 0.98
R2911:Abcf3 UTSW 16 20560232 missense probably damaging 0.98
R3081:Abcf3 UTSW 16 20559364 missense probably benign 0.09
R3852:Abcf3 UTSW 16 20560439 missense probably damaging 1.00
R4707:Abcf3 UTSW 16 20549058 missense possibly damaging 0.91
R4752:Abcf3 UTSW 16 20550576 missense probably damaging 1.00
R4885:Abcf3 UTSW 16 20551675 missense probably benign 0.05
R5672:Abcf3 UTSW 16 20549252 missense probably benign 0.00
R5817:Abcf3 UTSW 16 20549083 missense possibly damaging 0.95
R6013:Abcf3 UTSW 16 20550561 unclassified probably null
R6019:Abcf3 UTSW 16 20552451 missense possibly damaging 0.60
R6026:Abcf3 UTSW 16 20550570 missense probably damaging 1.00
R6952:Abcf3 UTSW 16 20549734 splice site probably null
R7431:Abcf3 UTSW 16 20558789 missense probably benign 0.00
R7539:Abcf3 UTSW 16 20552632 critical splice donor site probably null
R7764:Abcf3 UTSW 16 20549290 missense probably benign 0.36
X0066:Abcf3 UTSW 16 20559697 missense probably benign 0.11
Predicted Primers PCR Primer
(F):5'- TGCGTCCCGTTCTACTAGAC -3'
(R):5'- CAGTGTCTGTACAGCTCACTC -3'

Sequencing Primer
(F):5'- TACTAGACCCGCCCCCTG -3'
(R):5'- CCTCAAGATAAGAGGTCACGCAG -3'
Posted On2019-09-13