Incidental Mutation 'R7328:Ctdsp1'
ID569026
Institutional Source Beutler Lab
Gene Symbol Ctdsp1
Ensembl Gene ENSMUSG00000026176
Gene NameCTD (carboxy-terminal domain, RNA polymerase II, polypeptide A) small phosphatase 1
SynonymsSCP1
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7328 (G1)
Quality Score225.009
Status Not validated
Chromosome1
Chromosomal Location74391509-74397285 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 74394040 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 115 (I115F)
Ref Sequence ENSEMBL: ENSMUSP00000027367 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027367] [ENSMUST00000152659]
Predicted Effect probably damaging
Transcript: ENSMUST00000027367
AA Change: I115F

PolyPhen 2 Score 0.984 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000027367
Gene: ENSMUSG00000026176
AA Change: I115F

DomainStartEndE-ValueType
CPDc 89 232 9.18e-77 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000152659
AA Change: I122F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000114526
Gene: ENSMUSG00000026176
AA Change: I122F

DomainStartEndE-ValueType
low complexity region 1 13 N/A INTRINSIC
PDB:1T9Z|A 83 131 2e-26 PDB
Blast:CPDc 96 131 2e-16 BLAST
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the small C-terminal domain phosphatase (SCP) family of nuclear phosphatases. These proteins play a role in transcriptional regulation through specific dephosphorylation of phosphoserine 5 within tandem heptapeptide repeats of the C-terminal domain of RNA polymerase II. The encoded protein plays a role in neuronal gene silencing in non-neuronal cells, and may also inhibit osteoblast differentiation. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Oct 2011]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933427D14Rik C G 11: 72,169,780 probably null Het
Abca13 T A 11: 9,291,545 V1136E probably benign Het
Arl4c C A 1: 88,701,517 E50* probably null Het
Atxn7l1 T C 12: 33,148,503 probably null Het
Cyp2j5 A G 4: 96,663,213 V91A probably damaging Het
Dscam T A 16: 96,645,035 K1469* probably null Het
Elf2 A G 3: 51,266,777 C110R probably damaging Het
Ephb1 A G 9: 102,195,239 Y114H probably damaging Het
Ephb2 C T 4: 136,658,934 probably null Het
Fbxw20 C A 9: 109,232,315 C122F probably damaging Het
Flnb T A 14: 7,894,660 Y819* probably null Het
Flnb T C 14: 7,883,788 I338T possibly damaging Het
Foxo3 A T 10: 42,197,262 S420T probably benign Het
Herpud1 T C 8: 94,386,620 V10A possibly damaging Het
Hmcn1 A T 1: 150,638,866 V3585E possibly damaging Het
Hsdl1 T C 8: 119,566,091 T202A probably benign Het
Htr1d G A 4: 136,443,303 S281N probably benign Het
Igkv14-111 T A 6: 68,256,725 I70N probably damaging Het
Igkv8-34 A G 6: 70,044,344 S45P probably damaging Het
Inha T C 1: 75,510,116 Y352H probably damaging Het
Lats1 A T 10: 7,705,547 M699L possibly damaging Het
March9 T C 10: 127,058,296 E146G probably damaging Het
Mcm8 T C 2: 132,832,857 V443A probably benign Het
Melk A T 4: 44,332,931 S296C probably benign Het
Myo18a T C 11: 77,807,911 S4P Het
Myof T C 19: 37,916,399 Y1646C probably damaging Het
Noc4l C A 5: 110,648,923 A498S possibly damaging Het
Nrxn3 T C 12: 88,795,575 S131P probably benign Het
Olfr1052 GTACTTTTT GT 2: 86,297,994 probably null Het
Olfr291 T C 7: 84,857,299 I312T probably benign Het
Olfr937 T C 9: 39,060,561 Y35C probably damaging Het
Olfr993 A G 2: 85,414,324 I185T probably benign Het
Pcp4l1 G A 1: 171,174,465 A42V possibly damaging Het
Phldb2 T A 16: 45,758,209 probably null Het
Polr2b C T 5: 77,315,999 P81L probably damaging Het
Rbfa C A 18: 80,193,239 G215C probably benign Het
Rdh19 T C 10: 127,857,027 S188P probably damaging Het
Scn9a T C 2: 66,484,587 M1596V probably benign Het
Sele A T 1: 164,049,275 Y40F probably benign Het
Setd1b T A 5: 123,152,379 V803D unknown Het
Siglecf C T 7: 43,352,267 T167I possibly damaging Het
Slc39a6 T C 18: 24,600,930 E234G probably benign Het
Slco1a1 T A 6: 141,936,408 D145V possibly damaging Het
Son G A 16: 91,658,390 V1342I probably benign Het
Sybu G A 15: 44,787,794 P38L not run Het
Taf15 C T 11: 83,484,832 T41M possibly damaging Het
Tm4sf4 A T 3: 57,426,504 N71Y probably benign Het
Tm7sf2 C T 19: 6,064,126 V226I possibly damaging Het
Trim66 C A 7: 109,457,751 Q1066H probably damaging Het
Tyw1 T C 5: 130,262,844 V51A probably benign Het
Vav3 A T 3: 109,503,428 I192L probably benign Het
Other mutations in Ctdsp1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01954:Ctdsp1 APN 1 74394083 unclassified probably benign
IGL02011:Ctdsp1 APN 1 74394016 splice site probably benign
IGL02014:Ctdsp1 APN 1 74394016 splice site probably benign
IGL02205:Ctdsp1 APN 1 74393834 missense possibly damaging 0.65
IGL03011:Ctdsp1 APN 1 74395447 unclassified probably benign
R0811:Ctdsp1 UTSW 1 74394647 missense probably damaging 1.00
R0812:Ctdsp1 UTSW 1 74394647 missense probably damaging 1.00
R4725:Ctdsp1 UTSW 1 74394664 missense possibly damaging 0.65
R5777:Ctdsp1 UTSW 1 74394068 missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- TGTAAGAGGTGCCCTTCCAG -3'
(R):5'- AGGTAGTCTTGGGTTCTCACTC -3'

Sequencing Primer
(F):5'- AGACAAGATCTGCGTCGTCATCG -3'
(R):5'- CTTTCTGAGCTTTGGACACG -3'
Posted On2019-09-13