Incidental Mutation 'R7328:Tyw1'
ID569046
Institutional Source Beutler Lab
Gene Symbol Tyw1
Ensembl Gene ENSMUSG00000056310
Gene NametRNA-yW synthesizing protein 1 homolog (S. cerevisiae)
SynonymsRsafd1
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7328 (G1)
Quality Score225.009
Status Not validated
Chromosome5
Chromosomal Location130255619-130341563 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 130262844 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 51 (V51A)
Ref Sequence ENSEMBL: ENSMUSP00000037173 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000040213] [ENSMUST00000044204] [ENSMUST00000100662] [ENSMUST00000147619]
Predicted Effect probably benign
Transcript: ENSMUST00000040213
AA Change: V51A

PolyPhen 2 Score 0.077 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000037173
Gene: ENSMUSG00000056310
AA Change: V51A

DomainStartEndE-ValueType
transmembrane domain 20 39 N/A INTRINSIC
Pfam:Flavodoxin_1 73 224 1.6e-27 PFAM
low complexity region 276 288 N/A INTRINSIC
Pfam:Radical_SAM 399 581 1.1e-29 PFAM
Pfam:Wyosine_form 583 646 3.6e-29 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000044204
AA Change: V51A

PolyPhen 2 Score 0.504 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000047318
Gene: ENSMUSG00000056310
AA Change: V51A

DomainStartEndE-ValueType
transmembrane domain 20 39 N/A INTRINSIC
Pfam:Flavodoxin_1 73 224 1.5e-27 PFAM
low complexity region 276 288 N/A INTRINSIC
transmembrane domain 375 397 N/A INTRINSIC
transmembrane domain 423 445 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000100662
AA Change: V51A

PolyPhen 2 Score 0.035 (Sensitivity: 0.94; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000098226
Gene: ENSMUSG00000056310
AA Change: V51A

DomainStartEndE-ValueType
transmembrane domain 20 39 N/A INTRINSIC
Pfam:Flavodoxin_1 73 224 4.9e-28 PFAM
low complexity region 276 288 N/A INTRINSIC
low complexity region 319 332 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000147619
AA Change: V28A

PolyPhen 2 Score 0.077 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000123693
Gene: ENSMUSG00000056310
AA Change: V28A

DomainStartEndE-ValueType
Pfam:Flavodoxin_1 50 201 4.3e-28 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Wybutosine (yW) is a hypermodified guanosine found in phenylalanine tRNA adjacent to the anticodon that stabilizes codon-anticodon interactions in the ribosome. In yeast, the homolog of this gene is essential for the synthesis of wybutosine. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Dec 2015]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933427D14Rik C G 11: 72,169,780 probably null Het
Abca13 T A 11: 9,291,545 V1136E probably benign Het
Arl4c C A 1: 88,701,517 E50* probably null Het
Atxn7l1 T C 12: 33,148,503 probably null Het
Ctdsp1 A T 1: 74,394,040 I115F probably damaging Het
Cyp2j5 A G 4: 96,663,213 V91A probably damaging Het
Dscam T A 16: 96,645,035 K1469* probably null Het
Elf2 A G 3: 51,266,777 C110R probably damaging Het
Ephb1 A G 9: 102,195,239 Y114H probably damaging Het
Ephb2 C T 4: 136,658,934 probably null Het
Fbxw20 C A 9: 109,232,315 C122F probably damaging Het
Flnb T A 14: 7,894,660 Y819* probably null Het
Flnb T C 14: 7,883,788 I338T possibly damaging Het
Foxo3 A T 10: 42,197,262 S420T probably benign Het
Herpud1 T C 8: 94,386,620 V10A possibly damaging Het
Hmcn1 A T 1: 150,638,866 V3585E possibly damaging Het
Hsdl1 T C 8: 119,566,091 T202A probably benign Het
Htr1d G A 4: 136,443,303 S281N probably benign Het
Igkv14-111 T A 6: 68,256,725 I70N probably damaging Het
Igkv8-34 A G 6: 70,044,344 S45P probably damaging Het
Inha T C 1: 75,510,116 Y352H probably damaging Het
Lats1 A T 10: 7,705,547 M699L possibly damaging Het
March9 T C 10: 127,058,296 E146G probably damaging Het
Mcm8 T C 2: 132,832,857 V443A probably benign Het
Melk A T 4: 44,332,931 S296C probably benign Het
Myo18a T C 11: 77,807,911 S4P Het
Myof T C 19: 37,916,399 Y1646C probably damaging Het
Noc4l C A 5: 110,648,923 A498S possibly damaging Het
Nrxn3 T C 12: 88,795,575 S131P probably benign Het
Olfr1052 GTACTTTTT GT 2: 86,297,994 probably null Het
Olfr291 T C 7: 84,857,299 I312T probably benign Het
Olfr937 T C 9: 39,060,561 Y35C probably damaging Het
Olfr993 A G 2: 85,414,324 I185T probably benign Het
Pcp4l1 G A 1: 171,174,465 A42V possibly damaging Het
Phldb2 T A 16: 45,758,209 probably null Het
Polr2b C T 5: 77,315,999 P81L probably damaging Het
Rbfa C A 18: 80,193,239 G215C probably benign Het
Rdh19 T C 10: 127,857,027 S188P probably damaging Het
Scn9a T C 2: 66,484,587 M1596V probably benign Het
Sele A T 1: 164,049,275 Y40F probably benign Het
Setd1b T A 5: 123,152,379 V803D unknown Het
Siglecf C T 7: 43,352,267 T167I possibly damaging Het
Slc39a6 T C 18: 24,600,930 E234G probably benign Het
Slco1a1 T A 6: 141,936,408 D145V possibly damaging Het
Son G A 16: 91,658,390 V1342I probably benign Het
Sybu G A 15: 44,787,794 P38L not run Het
Taf15 C T 11: 83,484,832 T41M possibly damaging Het
Tm4sf4 A T 3: 57,426,504 N71Y probably benign Het
Tm7sf2 C T 19: 6,064,126 V226I possibly damaging Het
Trim66 C A 7: 109,457,751 Q1066H probably damaging Het
Vav3 A T 3: 109,503,428 I192L probably benign Het
Other mutations in Tyw1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02329:Tyw1 APN 5 130267080 missense probably benign 0.20
IGL02873:Tyw1 APN 5 130335330 missense probably benign 0.00
IGL02879:Tyw1 APN 5 130296771 missense probably damaging 1.00
IGL03080:Tyw1 APN 5 130267055 missense probably damaging 1.00
IGL03291:Tyw1 APN 5 130299993 missense probably damaging 1.00
IGL03297:Tyw1 APN 5 130340734 missense probably damaging 1.00
R1420:Tyw1 UTSW 5 130274745 critical splice donor site probably null
R1650:Tyw1 UTSW 5 130288911 missense possibly damaging 0.91
R1674:Tyw1 UTSW 5 130269328 missense probably benign 0.01
R1789:Tyw1 UTSW 5 130258993 missense probably damaging 0.99
R1996:Tyw1 UTSW 5 130262811 splice site probably benign
R2421:Tyw1 UTSW 5 130269260 missense probably damaging 1.00
R3913:Tyw1 UTSW 5 130259035 missense probably damaging 0.98
R4412:Tyw1 UTSW 5 130335232 splice site probably null
R4835:Tyw1 UTSW 5 130277058 missense probably benign
R5058:Tyw1 UTSW 5 130277086 missense probably benign 0.03
R5190:Tyw1 UTSW 5 130267915 nonsense probably null
R5398:Tyw1 UTSW 5 130277157 intron probably benign
R5459:Tyw1 UTSW 5 130274706 missense probably damaging 1.00
R5597:Tyw1 UTSW 5 130274657 missense probably benign 0.00
R5704:Tyw1 UTSW 5 130282022 nonsense probably null
R5825:Tyw1 UTSW 5 130268088 missense probably damaging 0.99
R5887:Tyw1 UTSW 5 130325699 missense probably damaging 1.00
R6072:Tyw1 UTSW 5 130267911 missense possibly damaging 0.92
R6349:Tyw1 UTSW 5 130277031 missense possibly damaging 0.82
R6366:Tyw1 UTSW 5 130281951 unclassified probably benign
R7012:Tyw1 UTSW 5 130277730 splice site probably null
R7259:Tyw1 UTSW 5 130267872 splice site probably null
R7555:Tyw1 UTSW 5 130274706 missense probably damaging 1.00
R8006:Tyw1 UTSW 5 130268072 missense possibly damaging 0.87
R8171:Tyw1 UTSW 5 130300014 missense probably benign 0.19
R8196:Tyw1 UTSW 5 130300021 missense probably damaging 1.00
R8714:Tyw1 UTSW 5 130269224 missense probably damaging 1.00
R8715:Tyw1 UTSW 5 130269224 missense probably damaging 1.00
R8716:Tyw1 UTSW 5 130269224 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGCCTTTTGAGGACCCAGTTAG -3'
(R):5'- AACTGCTAAAGAGGGTTGCTGG -3'

Sequencing Primer
(F):5'- CTGAGGTATACACTTAGGAAGTCTG -3'
(R):5'- GCTGGCATTTCCTTTAAACACTGG -3'
Posted On2019-09-13