Incidental Mutation 'R7328:Herpud1'
ID569053
Institutional Source Beutler Lab
Gene Symbol Herpud1
Ensembl Gene ENSMUSG00000031770
Gene Namehomocysteine-inducible, endoplasmic reticulum stress-inducible, ubiquitin-like domain member 1
SynonymsHerp, Mifl
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.245) question?
Stock #R7328 (G1)
Quality Score225.009
Status Not validated
Chromosome8
Chromosomal Location94386438-94395377 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 94386620 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 10 (V10A)
Ref Sequence ENSEMBL: ENSMUSP00000124201 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034220] [ENSMUST00000161085] [ENSMUST00000161576] [ENSMUST00000211982]
Predicted Effect possibly damaging
Transcript: ENSMUST00000034220
AA Change: V10A

PolyPhen 2 Score 0.820 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000034220
Gene: ENSMUSG00000031770
AA Change: V10A

DomainStartEndE-ValueType
UBQ 10 86 1.99e-13 SMART
low complexity region 216 242 N/A INTRINSIC
low complexity region 273 290 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000159450
Predicted Effect probably benign
Transcript: ENSMUST00000161085
Predicted Effect possibly damaging
Transcript: ENSMUST00000161576
AA Change: V10A

PolyPhen 2 Score 0.765 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000124201
Gene: ENSMUSG00000031770
AA Change: V10A

DomainStartEndE-ValueType
UBQ 10 87 7.55e-14 SMART
low complexity region 217 243 N/A INTRINSIC
low complexity region 274 291 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000211982
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The accumulation of unfolded proteins in the endoplasmic reticulum (ER) triggers the ER stress response. This response includes the inhibition of translation to prevent further accumulation of unfolded proteins, the increased expression of proteins involved in polypeptide folding, known as the unfolded protein response (UPR), and the destruction of misfolded proteins by the ER-associated protein degradation (ERAD) system. This gene may play a role in both UPR and ERAD. Its expression is induced by UPR and it has an ER stress response element in its promoter region while the encoded protein has an N-terminal ubiquitin-like domain which may interact with the ERAD system. This protein has been shown to interact with presenilin proteins and to increase the level of amyloid-beta protein following its overexpression. Alternative splicing of this gene produces multiple transcript variants encoding different isoforms. The full-length nature of all transcript variants has not been determined. [provided by RefSeq, Jan 2013]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit impaired glucose tolerance and decreased cerebral infarction size. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933427D14Rik C G 11: 72,169,780 probably null Het
Abca13 T A 11: 9,291,545 V1136E probably benign Het
Arl4c C A 1: 88,701,517 E50* probably null Het
Atxn7l1 T C 12: 33,148,503 probably null Het
Ctdsp1 A T 1: 74,394,040 I115F probably damaging Het
Cyp2j5 A G 4: 96,663,213 V91A probably damaging Het
Dscam T A 16: 96,645,035 K1469* probably null Het
Elf2 A G 3: 51,266,777 C110R probably damaging Het
Ephb1 A G 9: 102,195,239 Y114H probably damaging Het
Ephb2 C T 4: 136,658,934 probably null Het
Fbxw20 C A 9: 109,232,315 C122F probably damaging Het
Flnb T A 14: 7,894,660 Y819* probably null Het
Flnb T C 14: 7,883,788 I338T possibly damaging Het
Foxo3 A T 10: 42,197,262 S420T probably benign Het
Hmcn1 A T 1: 150,638,866 V3585E possibly damaging Het
Hsdl1 T C 8: 119,566,091 T202A probably benign Het
Htr1d G A 4: 136,443,303 S281N probably benign Het
Igkv14-111 T A 6: 68,256,725 I70N probably damaging Het
Igkv8-34 A G 6: 70,044,344 S45P probably damaging Het
Inha T C 1: 75,510,116 Y352H probably damaging Het
Lats1 A T 10: 7,705,547 M699L possibly damaging Het
March9 T C 10: 127,058,296 E146G probably damaging Het
Mcm8 T C 2: 132,832,857 V443A probably benign Het
Melk A T 4: 44,332,931 S296C probably benign Het
Myo18a T C 11: 77,807,911 S4P Het
Myof T C 19: 37,916,399 Y1646C probably damaging Het
Noc4l C A 5: 110,648,923 A498S possibly damaging Het
Nrxn3 T C 12: 88,795,575 S131P probably benign Het
Olfr1052 GTACTTTTT GT 2: 86,297,994 probably null Het
Olfr291 T C 7: 84,857,299 I312T probably benign Het
Olfr937 T C 9: 39,060,561 Y35C probably damaging Het
Olfr993 A G 2: 85,414,324 I185T probably benign Het
Pcp4l1 G A 1: 171,174,465 A42V possibly damaging Het
Phldb2 T A 16: 45,758,209 probably null Het
Polr2b C T 5: 77,315,999 P81L probably damaging Het
Rbfa C A 18: 80,193,239 G215C probably benign Het
Rdh19 T C 10: 127,857,027 S188P probably damaging Het
Scn9a T C 2: 66,484,587 M1596V probably benign Het
Sele A T 1: 164,049,275 Y40F probably benign Het
Setd1b T A 5: 123,152,379 V803D unknown Het
Siglecf C T 7: 43,352,267 T167I possibly damaging Het
Slc39a6 T C 18: 24,600,930 E234G probably benign Het
Slco1a1 T A 6: 141,936,408 D145V possibly damaging Het
Son G A 16: 91,658,390 V1342I probably benign Het
Sybu G A 15: 44,787,794 P38L not run Het
Taf15 C T 11: 83,484,832 T41M possibly damaging Het
Tm4sf4 A T 3: 57,426,504 N71Y probably benign Het
Tm7sf2 C T 19: 6,064,126 V226I possibly damaging Het
Trim66 C A 7: 109,457,751 Q1066H probably damaging Het
Tyw1 T C 5: 130,262,844 V51A probably benign Het
Vav3 A T 3: 109,503,428 I192L probably benign Het
Other mutations in Herpud1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02506:Herpud1 APN 8 94394642 nonsense probably null
R1667:Herpud1 UTSW 8 94389366 missense probably damaging 1.00
R2015:Herpud1 UTSW 8 94392206 missense probably benign 0.44
R2255:Herpud1 UTSW 8 94394613 missense probably benign 0.06
R3707:Herpud1 UTSW 8 94392239 missense probably damaging 1.00
R4940:Herpud1 UTSW 8 94390842 missense probably benign 0.18
R4961:Herpud1 UTSW 8 94390826 missense probably benign 0.00
R4981:Herpud1 UTSW 8 94391794 missense probably damaging 1.00
R5214:Herpud1 UTSW 8 94390851 splice site probably null
R5499:Herpud1 UTSW 8 94389413 missense probably damaging 1.00
R5835:Herpud1 UTSW 8 94392239 missense probably damaging 1.00
R5985:Herpud1 UTSW 8 94390794 missense probably damaging 1.00
R6702:Herpud1 UTSW 8 94392526 critical splice donor site probably null
R6794:Herpud1 UTSW 8 94394770 intron probably null
R7060:Herpud1 UTSW 8 94390763 missense probably benign 0.04
R7100:Herpud1 UTSW 8 94390847 missense probably damaging 0.98
R7384:Herpud1 UTSW 8 94389377 missense probably damaging 0.98
R7898:Herpud1 UTSW 8 94392200 missense probably benign 0.05
R7981:Herpud1 UTSW 8 94392200 missense probably benign 0.05
R8025:Herpud1 UTSW 8 94392521 missense probably damaging 1.00
R8036:Herpud1 UTSW 8 94392386 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGGACACTGACCTCTGTCTCAG -3'
(R):5'- ACAGGTGAGTTCAGGCAACC -3'

Sequencing Primer
(F):5'- TCTGTCTCAGCCAATGGATG -3'
(R):5'- CAACCCTGCAGGCGTGG -3'
Posted On2019-09-13