Incidental Mutation 'R7328:Olfr937'
ID569055
Institutional Source Beutler Lab
Gene Symbol Olfr937
Ensembl Gene ENSMUSG00000094182
Gene Nameolfactory receptor 937
SynonymsMOR171-24, GA_x6K02T2PVTD-32756567-32755632
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.095) question?
Stock #R7328 (G1)
Quality Score225.009
Status Not validated
Chromosome9
Chromosomal Location39058851-39064951 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 39060561 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 35 (Y35C)
Ref Sequence ENSEMBL: ENSMUSP00000150274 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000055567] [ENSMUST00000215049]
Predicted Effect probably damaging
Transcript: ENSMUST00000055567
AA Change: Y35C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000058346
Gene: ENSMUSG00000094182
AA Change: Y35C

DomainStartEndE-ValueType
Pfam:7tm_4 31 308 3.8e-49 PFAM
Pfam:7tm_1 41 290 1.7e-20 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000215049
AA Change: Y35C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933427D14Rik C G 11: 72,169,780 probably null Het
Abca13 T A 11: 9,291,545 V1136E probably benign Het
Arl4c C A 1: 88,701,517 E50* probably null Het
Atxn7l1 T C 12: 33,148,503 probably null Het
Ctdsp1 A T 1: 74,394,040 I115F probably damaging Het
Cyp2j5 A G 4: 96,663,213 V91A probably damaging Het
Dscam T A 16: 96,645,035 K1469* probably null Het
Elf2 A G 3: 51,266,777 C110R probably damaging Het
Ephb1 A G 9: 102,195,239 Y114H probably damaging Het
Ephb2 C T 4: 136,658,934 probably null Het
Fbxw20 C A 9: 109,232,315 C122F probably damaging Het
Flnb T C 14: 7,883,788 I338T possibly damaging Het
Flnb T A 14: 7,894,660 Y819* probably null Het
Foxo3 A T 10: 42,197,262 S420T probably benign Het
Herpud1 T C 8: 94,386,620 V10A possibly damaging Het
Hmcn1 A T 1: 150,638,866 V3585E possibly damaging Het
Hsdl1 T C 8: 119,566,091 T202A probably benign Het
Htr1d G A 4: 136,443,303 S281N probably benign Het
Igkv14-111 T A 6: 68,256,725 I70N probably damaging Het
Igkv8-34 A G 6: 70,044,344 S45P probably damaging Het
Inha T C 1: 75,510,116 Y352H probably damaging Het
Lats1 A T 10: 7,705,547 M699L possibly damaging Het
March9 T C 10: 127,058,296 E146G probably damaging Het
Mcm8 T C 2: 132,832,857 V443A probably benign Het
Melk A T 4: 44,332,931 S296C probably benign Het
Myo18a T C 11: 77,807,911 S4P Het
Myof T C 19: 37,916,399 Y1646C probably damaging Het
Noc4l C A 5: 110,648,923 A498S possibly damaging Het
Nrxn3 T C 12: 88,795,575 S131P probably benign Het
Olfr1052 GTACTTTTT GT 2: 86,297,994 probably null Het
Olfr291 T C 7: 84,857,299 I312T probably benign Het
Olfr993 A G 2: 85,414,324 I185T probably benign Het
Pcp4l1 G A 1: 171,174,465 A42V possibly damaging Het
Phldb2 T A 16: 45,758,209 probably null Het
Polr2b C T 5: 77,315,999 P81L probably damaging Het
Rbfa C A 18: 80,193,239 G215C probably benign Het
Rdh19 T C 10: 127,857,027 S188P probably damaging Het
Scn9a T C 2: 66,484,587 M1596V probably benign Het
Sele A T 1: 164,049,275 Y40F probably benign Het
Setd1b T A 5: 123,152,379 V803D unknown Het
Siglecf C T 7: 43,352,267 T167I possibly damaging Het
Slc39a6 T C 18: 24,600,930 E234G probably benign Het
Slco1a1 T A 6: 141,936,408 D145V possibly damaging Het
Son G A 16: 91,658,390 V1342I probably benign Het
Sybu G A 15: 44,787,794 P38L not run Het
Taf15 C T 11: 83,484,832 T41M possibly damaging Het
Tm4sf4 A T 3: 57,426,504 N71Y probably benign Het
Tm7sf2 C T 19: 6,064,126 V226I possibly damaging Het
Trim66 C A 7: 109,457,751 Q1066H probably damaging Het
Tyw1 T C 5: 130,262,844 V51A probably benign Het
Vav3 A T 3: 109,503,428 I192L probably benign Het
Other mutations in Olfr937
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00158:Olfr937 APN 9 39059863 missense probably benign 0.03
IGL01387:Olfr937 APN 9 39060321 missense probably damaging 1.00
IGL01775:Olfr937 APN 9 39060467 missense probably damaging 1.00
IGL02076:Olfr937 APN 9 39060585 missense probably damaging 1.00
IGL02740:Olfr937 APN 9 39060289 missense probably benign 0.22
IGL03115:Olfr937 APN 9 39059963 missense probably damaging 0.99
R0121:Olfr937 UTSW 9 39059760 missense probably damaging 1.00
R0908:Olfr937 UTSW 9 39059947 missense probably damaging 1.00
R1559:Olfr937 UTSW 9 39060141 missense probably benign 0.20
R2006:Olfr937 UTSW 9 39060433 missense probably damaging 0.99
R2010:Olfr937 UTSW 9 39060099 missense probably benign 0.05
R2191:Olfr937 UTSW 9 39060405 missense probably benign
R3874:Olfr937 UTSW 9 39060174 missense probably benign 0.00
R4970:Olfr937 UTSW 9 39060531 missense probably benign 0.12
R5217:Olfr937 UTSW 9 39059769 missense probably benign 0.00
R5836:Olfr937 UTSW 9 39060622 missense probably benign
R5886:Olfr937 UTSW 9 39060382 missense probably benign 0.00
R6109:Olfr937 UTSW 9 39060196 missense probably benign 0.23
R7261:Olfr937 UTSW 9 39060208 missense possibly damaging 0.64
R7345:Olfr937 UTSW 9 39060579 missense probably damaging 1.00
R7419:Olfr937 UTSW 9 39060169 missense probably benign 0.00
X0022:Olfr937 UTSW 9 39060417 missense probably benign 0.12
Predicted Primers PCR Primer
(F):5'- ATGCATCCAGTGTAGGAAATGATG -3'
(R):5'- TGCTCACTGGCAGTATGTAATG -3'

Sequencing Primer
(F):5'- CCAGTGTAGGAAATGATGTTTTTCTC -3'
(R):5'- CACTGGCAGTATGTAATGTATCAAG -3'
Posted On2019-09-13