Incidental Mutation 'R7328:Fbxw20'
ID569057
Institutional Source Beutler Lab
Gene Symbol Fbxw20
Ensembl Gene ENSMUSG00000061701
Gene NameF-box and WD-40 domain protein 20
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.078) question?
Stock #R7328 (G1)
Quality Score225.009
Status Not validated
Chromosome9
Chromosomal Location109217432-109234754 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 109232315 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Phenylalanine at position 122 (C122F)
Ref Sequence ENSEMBL: ENSMUSP00000078503 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000079548] [ENSMUST00000197329]
Predicted Effect probably damaging
Transcript: ENSMUST00000079548
AA Change: C122F

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000078503
Gene: ENSMUSG00000061701
AA Change: C122F

DomainStartEndE-ValueType
FBOX 5 45 2.37e-6 SMART
SCOP:d1tbga_ 116 249 5e-8 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000197329
AA Change: C122F

PolyPhen 2 Score 0.985 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000143126
Gene: ENSMUSG00000061701
AA Change: C122F

DomainStartEndE-ValueType
FBOX 5 45 1.5e-8 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933427D14Rik C G 11: 72,169,780 probably null Het
Abca13 T A 11: 9,291,545 V1136E probably benign Het
Arl4c C A 1: 88,701,517 E50* probably null Het
Atxn7l1 T C 12: 33,148,503 probably null Het
Ctdsp1 A T 1: 74,394,040 I115F probably damaging Het
Cyp2j5 A G 4: 96,663,213 V91A probably damaging Het
Dscam T A 16: 96,645,035 K1469* probably null Het
Elf2 A G 3: 51,266,777 C110R probably damaging Het
Ephb1 A G 9: 102,195,239 Y114H probably damaging Het
Ephb2 C T 4: 136,658,934 probably null Het
Flnb T C 14: 7,883,788 I338T possibly damaging Het
Flnb T A 14: 7,894,660 Y819* probably null Het
Foxo3 A T 10: 42,197,262 S420T probably benign Het
Herpud1 T C 8: 94,386,620 V10A possibly damaging Het
Hmcn1 A T 1: 150,638,866 V3585E possibly damaging Het
Hsdl1 T C 8: 119,566,091 T202A probably benign Het
Htr1d G A 4: 136,443,303 S281N probably benign Het
Igkv14-111 T A 6: 68,256,725 I70N probably damaging Het
Igkv8-34 A G 6: 70,044,344 S45P probably damaging Het
Inha T C 1: 75,510,116 Y352H probably damaging Het
Lats1 A T 10: 7,705,547 M699L possibly damaging Het
March9 T C 10: 127,058,296 E146G probably damaging Het
Mcm8 T C 2: 132,832,857 V443A probably benign Het
Melk A T 4: 44,332,931 S296C probably benign Het
Myo18a T C 11: 77,807,911 S4P Het
Myof T C 19: 37,916,399 Y1646C probably damaging Het
Noc4l C A 5: 110,648,923 A498S possibly damaging Het
Nrxn3 T C 12: 88,795,575 S131P probably benign Het
Olfr1052 GTACTTTTT GT 2: 86,297,994 probably null Het
Olfr291 T C 7: 84,857,299 I312T probably benign Het
Olfr937 T C 9: 39,060,561 Y35C probably damaging Het
Olfr993 A G 2: 85,414,324 I185T probably benign Het
Pcp4l1 G A 1: 171,174,465 A42V possibly damaging Het
Phldb2 T A 16: 45,758,209 probably null Het
Polr2b C T 5: 77,315,999 P81L probably damaging Het
Rbfa C A 18: 80,193,239 G215C probably benign Het
Rdh19 T C 10: 127,857,027 S188P probably damaging Het
Scn9a T C 2: 66,484,587 M1596V probably benign Het
Sele A T 1: 164,049,275 Y40F probably benign Het
Setd1b T A 5: 123,152,379 V803D unknown Het
Siglecf C T 7: 43,352,267 T167I possibly damaging Het
Slc39a6 T C 18: 24,600,930 E234G probably benign Het
Slco1a1 T A 6: 141,936,408 D145V possibly damaging Het
Son G A 16: 91,658,390 V1342I probably benign Het
Sybu G A 15: 44,787,794 P38L not run Het
Taf15 C T 11: 83,484,832 T41M possibly damaging Het
Tm4sf4 A T 3: 57,426,504 N71Y probably benign Het
Tm7sf2 C T 19: 6,064,126 V226I possibly damaging Het
Trim66 C A 7: 109,457,751 Q1066H probably damaging Het
Tyw1 T C 5: 130,262,844 V51A probably benign Het
Vav3 A T 3: 109,503,428 I192L probably benign Het
Other mutations in Fbxw20
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00228:Fbxw20 APN 9 109234702 start codon destroyed probably damaging 0.97
IGL01764:Fbxw20 APN 9 109223359 missense possibly damaging 0.71
IGL02149:Fbxw20 APN 9 109233818 critical splice donor site probably null
IGL02307:Fbxw20 APN 9 109233533 missense possibly damaging 0.70
IGL02335:Fbxw20 APN 9 109223309 missense possibly damaging 0.91
IGL02338:Fbxw20 APN 9 109225978 missense probably benign 0.00
PIT4377001:Fbxw20 UTSW 9 109221727 missense probably benign 0.00
PIT4434001:Fbxw20 UTSW 9 109223432 missense probably damaging 1.00
R0652:Fbxw20 UTSW 9 109232332 missense probably damaging 1.00
R1018:Fbxw20 UTSW 9 109221336 missense probably benign 0.03
R1114:Fbxw20 UTSW 9 109223482 missense probably damaging 1.00
R1596:Fbxw20 UTSW 9 109221300 missense probably damaging 1.00
R1692:Fbxw20 UTSW 9 109221709 missense possibly damaging 0.73
R1967:Fbxw20 UTSW 9 109217510 missense probably benign 0.00
R2055:Fbxw20 UTSW 9 109221374 missense probably damaging 0.99
R2224:Fbxw20 UTSW 9 109233582 missense possibly damaging 0.50
R4394:Fbxw20 UTSW 9 109232330 missense probably benign 0.00
R4617:Fbxw20 UTSW 9 109217563 missense probably damaging 1.00
R4858:Fbxw20 UTSW 9 109234695 missense possibly damaging 0.54
R5794:Fbxw20 UTSW 9 109223290 missense probably damaging 0.97
R5794:Fbxw20 UTSW 9 109233600 missense possibly damaging 0.95
R6090:Fbxw20 UTSW 9 109223363 missense probably benign 0.03
R7161:Fbxw20 UTSW 9 109225980 missense probably damaging 1.00
R8004:Fbxw20 UTSW 9 109221381 missense probably damaging 1.00
R8258:Fbxw20 UTSW 9 109234695 missense probably benign 0.18
R8259:Fbxw20 UTSW 9 109234695 missense probably benign 0.18
Z1177:Fbxw20 UTSW 9 109225887 frame shift probably null
Predicted Primers PCR Primer
(F):5'- GCCCTGCAGAGATGGCTTAG -3'
(R):5'- AGCCTTCTTCATGGCAGAGAG -3'

Sequencing Primer
(F):5'- AAGGGACCTGACATCCTCTTGTG -3'
(R):5'- CCTTCTTCATGGCAGAGAGAAGGG -3'
Posted On2019-09-13