Mutagenetix > Incidental Mutation

Incidental Mutation 'R7328:Lats1'

569058

Institutional Source

Beutler Lab

Gene Symbol

Lats1

Ensembl Gene

ENSMUSG00000040021

Gene Name

large tumor suppressor

Synonyms

MMRRC Submission

045421-MU

Accession Numbers

Essential gene?

Probably essential (E-score: 0.890) question?

Stock #

R7328 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

7681214-7716460 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 7705547 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Methionine to Leucine at position 699 (M699L)

Ref Sequence

ENSEMBL: ENSMUSP00000132078 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000040043] [ENSMUST00000165952] [ENSMUST00000217931]

AlphaFold

Q8BYR2

Predicted Effect

possibly damaging
Transcript: ENSMUST00000040043
AA Change: M699L

PolyPhen 2 Score 0.618 (Sensitivity: 0.87; Specificity: 0.91)

SMART Domains

Protein: ENSMUSP00000041915
Gene: ENSMUSG00000040021
AA Change: M699L

Domain	Start	End	E-Value	Type
Pfam:UBA	101	138	7.4e-11	PFAM
low complexity region	228	267	N/A	INTRINSIC
low complexity region	301	314	N/A	INTRINSIC
low complexity region	371	379	N/A	INTRINSIC
low complexity region	433	445	N/A	INTRINSIC
low complexity region	482	493	N/A	INTRINSIC
low complexity region	520	530	N/A	INTRINSIC
low complexity region	554	559	N/A	INTRINSIC
S_TKc	704	1009	7.3e-99	SMART
S_TK_X	1010	1081	1.2e-2	SMART
low complexity region	1102	1120	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000165952
AA Change: M699L

PolyPhen 2 Score 0.618 (Sensitivity: 0.87; Specificity: 0.91)

SMART Domains

Protein: ENSMUSP00000132078
Gene: ENSMUSG00000040021
AA Change: M699L

Domain	Start	End	E-Value	Type
Pfam:UBA	101	138	7.4e-11	PFAM
low complexity region	228	267	N/A	INTRINSIC
low complexity region	301	314	N/A	INTRINSIC
low complexity region	371	379	N/A	INTRINSIC
low complexity region	433	445	N/A	INTRINSIC
low complexity region	482	493	N/A	INTRINSIC
low complexity region	520	530	N/A	INTRINSIC
low complexity region	554	559	N/A	INTRINSIC
S_TKc	704	1009	7.3e-99	SMART
S_TK_X	1010	1081	1.2e-2	SMART
low complexity region	1102	1120	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000217931
AA Change: M699L

PolyPhen 2 Score 0.618 (Sensitivity: 0.87; Specificity: 0.91)

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.7%
20x: 99.0%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a putative serine/threonine kinase that localizes to the mitotic apparatus and complexes with cell cycle controller CDC2 kinase in early mitosis. The protein is phosphorylated in a cell-cycle dependent manner, with late prophase phosphorylation remaining through metaphase. The N-terminal region of the protein binds CDC2 to form a complex showing reduced H1 histone kinase activity, indicating a role as a negative regulator of CDC2/cyclin A. In addition, the C-terminal kinase domain binds to its own N-terminal region, suggesting potential negative regulation through interference with complex formation via intramolecular binding. Biochemical and genetic data suggest a role as a tumor suppressor. This is supported by studies in knockout mice showing development of soft-tissue sarcomas, ovarian stromal cell tumors and a high sensitivity to carcinogenic treatments. Two protein-coding transcripts and one non-protein coding transcript have been found for this gene. [provided by RefSeq, Jul 2012]
PHENOTYPE: Homozygotes for a targeted null mutation exhibit high postnatal mortality, lack of mammary development, infertility, pituitary hyperplasia, reduced hormone levels, growth retardation, and susceptibility to sarcomas and ovarian stromal cell tumors. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 51 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4933427D14Rik	C	G	11: 72,169,780		probably null	Het
Abca13	T	A	11: 9,291,545	V1136E	probably benign	Het
Arl4c	C	A	1: 88,701,517	E50*	probably null	Het
Atxn7l1	T	C	12: 33,148,503		probably null	Het
Ctdsp1	A	T	1: 74,394,040	I115F	probably damaging	Het
Cyp2j5	A	G	4: 96,663,213	V91A	probably damaging	Het
Dscam	T	A	16: 96,645,035	K1469*	probably null	Het
Elf2	A	G	3: 51,266,777	C110R	probably damaging	Het
Ephb1	A	G	9: 102,195,239	Y114H	probably damaging	Het
Ephb2	C	T	4: 136,658,934		probably null	Het
Fbxw20	C	A	9: 109,232,315	C122F	probably damaging	Het
Flnb	T	A	14: 7,894,660	Y819*	probably null	Het
Flnb	T	C	14: 7,883,788	I338T	possibly damaging	Het
Foxo3	A	T	10: 42,197,262	S420T	probably benign	Het
Herpud1	T	C	8: 94,386,620	V10A	possibly damaging	Het
Hmcn1	A	T	1: 150,638,866	V3585E	possibly damaging	Het
Hsdl1	T	C	8: 119,566,091	T202A	probably benign	Het
Htr1d	G	A	4: 136,443,303	S281N	probably benign	Het
Igkv14-111	T	A	6: 68,256,725	I70N	probably damaging	Het
Igkv8-34	A	G	6: 70,044,344	S45P	probably damaging	Het
Inha	T	C	1: 75,510,116	Y352H	probably damaging	Het
March9	T	C	10: 127,058,296	E146G	probably damaging	Het
Mcm8	T	C	2: 132,832,857	V443A	probably benign	Het
Melk	A	T	4: 44,332,931	S296C	probably benign	Het
Myo18a	T	C	11: 77,807,911	S4P		Het
Myof	T	C	19: 37,916,399	Y1646C	probably damaging	Het
Noc4l	C	A	5: 110,648,923	A498S	possibly damaging	Het
Nrxn3	T	C	12: 88,795,575	S131P	probably benign	Het
Olfr1052	GTACTTTTT	GT	2: 86,297,994		probably null	Het
Olfr291	T	C	7: 84,857,299	I312T	probably benign	Het
Olfr937	T	C	9: 39,060,561	Y35C	probably damaging	Het
Olfr993	A	G	2: 85,414,324	I185T	probably benign	Het
Pcp4l1	G	A	1: 171,174,465	A42V	possibly damaging	Het
Phldb2	T	A	16: 45,758,209		probably null	Het
Polr2b	C	T	5: 77,315,999	P81L	probably damaging	Het
Rbfa	C	A	18: 80,193,239	G215C	probably benign	Het
Rdh19	T	C	10: 127,857,027	S188P	probably damaging	Het
Scn9a	T	C	2: 66,484,587	M1596V	probably benign	Het
Sele	A	T	1: 164,049,275	Y40F	probably benign	Het
Setd1b	T	A	5: 123,152,379	V803D	unknown	Het
Siglecf	C	T	7: 43,352,267	T167I	possibly damaging	Het
Slc39a6	T	C	18: 24,600,930	E234G	probably benign	Het
Slco1a1	T	A	6: 141,936,408	D145V	possibly damaging	Het
Son	G	A	16: 91,658,390	V1342I	probably benign	Het
Sybu	G	A	15: 44,787,794	P38L	not run	Het
Taf15	C	T	11: 83,484,832	T41M	possibly damaging	Het
Tm4sf4	A	T	3: 57,426,504	N71Y	probably benign	Het
Tm7sf2	C	T	19: 6,064,126	V226I	possibly damaging	Het
Trim66	C	A	7: 109,457,751	Q1066H	probably damaging	Het
Tyw1	T	C	5: 130,262,844	V51A	probably benign	Het
Vav3	A	T	3: 109,503,428	I192L	probably benign	Het

Other mutations in Lats1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00234:Lats1	APN	10	7691566	missense	probably damaging	0.99
IGL00595:Lats1	APN	10	7702305	missense	probably benign	0.00
IGL00932:Lats1	APN	10	7712742	missense	possibly damaging	0.69
IGL01019:Lats1	APN	10	7705671	missense	probably damaging	1.00
IGL01380:Lats1	APN	10	7691780	missense	possibly damaging	0.69
IGL01965:Lats1	APN	10	7701706	missense	probably benign	0.10
IGL02027:Lats1	APN	10	7712948	missense	probably benign
IGL02611:Lats1	APN	10	7705787	missense	possibly damaging	0.91
IGL02997:Lats1	APN	10	7702254	missense	possibly damaging	0.53
IGL03107:Lats1	APN	10	7712746	missense	probably benign	0.15
I1329:Lats1	UTSW	10	7712802	missense	probably benign	0.10
PIT4378001:Lats1	UTSW	10	7705605	missense	probably damaging	1.00
R0153:Lats1	UTSW	10	7691575	missense	probably damaging	1.00
R0568:Lats1	UTSW	10	7712528	missense	possibly damaging	0.69
R0581:Lats1	UTSW	10	7702941	missense	possibly damaging	0.67
R0604:Lats1	UTSW	10	7712661	missense	probably damaging	0.96
R1681:Lats1	UTSW	10	7705914	missense	probably damaging	0.99
R1694:Lats1	UTSW	10	7701945	missense	probably benign	0.07
R1840:Lats1	UTSW	10	7710939	nonsense	probably null
R1914:Lats1	UTSW	10	7710457	splice site	probably benign
R2137:Lats1	UTSW	10	7701847	missense	possibly damaging	0.71
R2317:Lats1	UTSW	10	7691776	nonsense	probably null
R3863:Lats1	UTSW	10	7705746	missense	probably damaging	1.00
R3864:Lats1	UTSW	10	7705746	missense	probably damaging	1.00
R4597:Lats1	UTSW	10	7691746	missense	probably benign	0.00
R4657:Lats1	UTSW	10	7705684	missense	possibly damaging	0.82
R4658:Lats1	UTSW	10	7702729	missense	probably benign
R4663:Lats1	UTSW	10	7712583	missense	probably damaging	1.00
R4870:Lats1	UTSW	10	7705785	missense	probably damaging	1.00
R5101:Lats1	UTSW	10	7712584	nonsense	probably null
R5134:Lats1	UTSW	10	7691811	missense	probably benign	0.34
R5150:Lats1	UTSW	10	7712651	missense	probably benign
R5546:Lats1	UTSW	10	7705754	missense	probably damaging	0.99
R5820:Lats1	UTSW	10	7705908	missense	probably damaging	1.00
R6006:Lats1	UTSW	10	7705595	missense	probably damaging	1.00
R6301:Lats1	UTSW	10	7703107	missense	probably benign	0.01
R6544:Lats1	UTSW	10	7701670	missense	possibly damaging	0.94
R6647:Lats1	UTSW	10	7697507	missense	possibly damaging	0.81
R6874:Lats1	UTSW	10	7710851	missense	probably damaging	1.00
R7390:Lats1	UTSW	10	7702095	nonsense	probably null
R7438:Lats1	UTSW	10	7712942	nonsense	probably null
R7457:Lats1	UTSW	10	7710891	missense	probably damaging	1.00
R7524:Lats1	UTSW	10	7701978	missense	possibly damaging	0.89
R7593:Lats1	UTSW	10	7701712	missense	probably damaging	1.00
R7736:Lats1	UTSW	10	7702364	missense	probably damaging	1.00
R7884:Lats1	UTSW	10	7697526	nonsense	probably null
R8166:Lats1	UTSW	10	7702116	missense	probably benign
R8248:Lats1	UTSW	10	7705903	missense	probably damaging	1.00
R8458:Lats1	UTSW	10	7710924	nonsense	probably null
R8477:Lats1	UTSW	10	7705515	missense	probably damaging	1.00
R8547:Lats1	UTSW	10	7712849	missense	probably damaging	1.00
R9163:Lats1	UTSW	10	7702288	missense	probably benign
R9441:Lats1	UTSW	10	7702917	missense	probably damaging	0.96
R9673:Lats1	UTSW	10	7712623	missense	probably benign	0.29
RF021:Lats1	UTSW	10	7710608	missense	probably damaging	1.00
X0026:Lats1	UTSW	10	7710623	missense	probably damaging	1.00
X0053:Lats1	UTSW	10	7691609	missense	probably benign	0.00
Z1176:Lats1	UTSW	10	7705809	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TTGCACACGTACTCACTTTGTG -3'
(R):5'- TGCTAGGATATCCCTCTCCG -3'

Sequencing Primer
(F):5'- GCACACGTACTCACTTTGTGTAGTG -3'
(R):5'- GCTTTCACATGAGCCACCTG -3'

Posted On

2019-09-13