Mutagenetix > Incidental Mutation

Incidental Mutation 'R0639:Agbl3'

56907

Institutional Source

Beutler Lab

Gene Symbol

Agbl3

Ensembl Gene

ENSMUSG00000038836

Gene Name

ATP/GTP binding protein-like 3

Synonyms

4930431N21Rik, 2900053G10Rik, 6530406M24Rik

MMRRC Submission

038828-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R0639 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

34780432-34859459 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 34799705 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Leucine to Glutamine at position 377 (L377Q)

Ref Sequence

ENSEMBL: ENSMUSP00000110669 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000115016] [ENSMUST00000115017] [ENSMUST00000135304] [ENSMUST00000148834]

AlphaFold

Q8CDP0

Predicted Effect

probably damaging
Transcript: ENSMUST00000115016
AA Change: L382Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000110668
Gene: ENSMUSG00000038836
AA Change: L382Q

Domain	Start	End	E-Value	Type
low complexity region	2	25	N/A	INTRINSIC
Pfam:Peptidase_M14	314	563	2.7e-19	PFAM
low complexity region	614	629	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000115017
AA Change: L377Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000110669
Gene: ENSMUSG00000038836
AA Change: L377Q

Domain	Start	End	E-Value	Type
low complexity region	2	25	N/A	INTRINSIC
Pfam:Peptidase_M14	309	560	1e-33	PFAM
low complexity region	609	624	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000135304

SMART Domains

Protein: ENSMUSP00000118303
Gene: ENSMUSG00000038836

Domain	Start	End	E-Value	Type
low complexity region	2	25	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000143474

Predicted Effect

probably benign
Transcript: ENSMUST00000148834

SMART Domains

Protein: ENSMUSP00000116066
Gene: ENSMUSG00000038836

Domain	Start	End	E-Value	Type
low complexity region	2	25	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000155726

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000155890

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000202017

Coding Region Coverage

1x: 99.4%
3x: 98.9%
10x: 97.7%
20x: 95.7%

Validation Efficiency

MGI Phenotype

PHENOTYPE: Homozygous mice for a targeted allele are viable and fertile. Mice homozygous for a knock-out allele exhibit normal response to herpes simplex virus (HSV) and vaccinia virus (VACV) infection. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 104 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1600014C23Rik	C	T	17: 45,733,073	W86*	probably null	Het
5830411N06Rik	A	G	7: 140,247,959	N27D	probably benign	Het
Acadl	T	C	1: 66,857,408	H75R	probably benign	Het
Adamtsl1	T	C	4: 86,277,143	F599S	probably damaging	Het
Adrb3	T	C	8: 27,228,265	N52S	probably damaging	Het
Akap9	T	C	5: 4,060,318	L3007P	probably damaging	Het
Amer3	T	A	1: 34,587,821	Y380*	probably null	Het
Ankrd13d	A	T	19: 4,273,019		probably null	Het
Ap4m1	T	A	5: 138,176,239	C235S	probably benign	Het
Arhgap29	T	C	3: 122,007,641	F675S	probably damaging	Het
Asah2	C	A	19: 32,008,639	V544F	probably damaging	Het
Ash2l	A	G	8: 25,823,291	I389T	possibly damaging	Het
Bend5	T	C	4: 111,433,298	S164P	probably benign	Het
Cacna1d	A	G	14: 30,171,294		probably null	Het
Cdc25b	A	G	2: 131,197,262	N516D	probably benign	Het
Cdc27	A	G	11: 104,531,734	Y125H	probably damaging	Het
Cdk5r2	C	T	1: 74,855,836	L247F	probably damaging	Het
Cenpf	C	A	1: 189,658,062	G1191V	probably benign	Het
Cops4	C	T	5: 100,537,460	T293I	possibly damaging	Het
Csmd3	A	G	15: 47,913,940	L1294P	probably damaging	Het
Dclre1a	T	C	19: 56,538,440	Y848C	probably damaging	Het
Disp2	A	T	2: 118,790,844	I686F	possibly damaging	Het
Dnah6	T	A	6: 73,022,412	Y4012F	probably benign	Het
Dnajc11	C	G	4: 151,969,936	R200G	probably damaging	Het
Dnhd1	A	T	7: 105,696,464	D2272V	possibly damaging	Het
Elane	A	C	10: 79,886,349	R5S	possibly damaging	Het
Entpd7	G	A	19: 43,691,094	V29M	probably benign	Het
Fanca	A	G	8: 123,289,359		probably null	Het
Fgl1	G	T	8: 41,191,624	T281K	probably benign	Het
Flii	T	C	11: 60,722,997		probably null	Het
Foxn1	T	C	11: 78,371,144	D133G	possibly damaging	Het
Fzd7	T	A	1: 59,484,560	M534K	probably damaging	Het
Galnt5	A	G	2: 57,999,395	T336A	probably benign	Het
Gli3	G	A	13: 15,724,715	D896N	probably damaging	Het
Gsx1	G	T	5: 147,189,946	W193L	probably damaging	Het
Gtpbp3	A	T	8: 71,492,735	I485F	probably damaging	Het
H2-M11	A	G	17: 36,547,391	T26A	probably benign	Het
Igfbp7	T	C	5: 77,351,980	D243G	probably damaging	Het
Il31ra	A	T	13: 112,525,843	D477E	possibly damaging	Het
Inmt	A	C	6: 55,171,227	V139G	probably damaging	Het
Inpp5j	T	A	11: 3,501,147	M501L	probably benign	Het
Itsn2	T	C	12: 4,712,556	F1579L	probably damaging	Het
Kat2b	C	A	17: 53,567,538	A70E	probably benign	Het
Klhl20	T	C	1: 161,093,711	E58G	probably damaging	Het
Krt79	A	T	15: 101,931,548	Y337*	probably null	Het
Krt81	C	A	15: 101,463,627	R24L	possibly damaging	Het
Letm1	T	C	5: 33,769,426	I176V	possibly damaging	Het
Lingo3	C	A	10: 80,835,784	R104L	probably benign	Het
Lrig3	T	G	10: 126,010,221	C840G	probably damaging	Het
Lrrc9	A	G	12: 72,486,288	N977S	probably damaging	Het
Lrrk2	T	A	15: 91,772,996	M1831K	probably benign	Het
Mn1	A	T	5: 111,419,316	D384V	probably damaging	Het
Morc3	C	A	16: 93,853,850	H319Q	probably damaging	Het
Morn1	T	C	4: 155,089,503	F56L	possibly damaging	Het
Mrpl53	G	T	6: 83,109,411	V64L	probably damaging	Het
Myo15	T	A	11: 60,479,336	V974D	probably benign	Het
Neb	A	G	2: 52,256,124	V2947A	possibly damaging	Het
Nfasc	A	C	1: 132,603,816	N737K	probably damaging	Het
Nlk	T	C	11: 78,572,277	D464G	possibly damaging	Het
Nlrc4	C	T	17: 74,426,963	R985K	probably benign	Het
Nsun6	T	C	2: 14,996,336	K470E	probably benign	Het
Nup85	T	G	11: 115,564,531	M1R	probably null	Het
Olfr887	G	A	9: 38,085,370	C178Y	probably damaging	Het
Otop1	T	C	5: 38,287,948	V150A	possibly damaging	Het
Pclo	C	T	5: 14,681,749	R296*	probably null	Het
Pdzd2	A	T	15: 12,458,058	C240S	possibly damaging	Het
Plekhg5	A	G	4: 152,114,120	T922A	probably benign	Het
Plekhm2	A	C	4: 141,642,070	L101R	probably damaging	Het
Plscr3	T	A	11: 69,847,994	C161S	probably benign	Het
Prr14l	C	T	5: 32,828,915	D1079N	probably benign	Het
Ptpru	A	T	4: 131,771,179	V1377E	possibly damaging	Het
Rab37	C	A	11: 115,158,702	D112E	probably benign	Het
Raet1e	T	A	10: 22,174,375	I19N	probably damaging	Het
Rassf5	T	C	1: 131,245,066	Y22C	probably damaging	Het
Rp1	T	C	1: 4,346,498	T1464A	probably benign	Het
Safb	T	A	17: 56,601,092		probably benign	Het
Scarf2	A	G	16: 17,806,505		probably null	Het
Sh3d19	T	C	3: 86,106,973	S415P	probably benign	Het
Slc26a9	T	A	1: 131,763,804	L595Q	probably damaging	Het
Slc4a8	T	C	15: 100,796,550	Y470H	probably damaging	Het
Slitrk3	T	C	3: 73,049,649	N597D	probably benign	Het
Spata31	T	A	13: 64,922,213	V725E	probably benign	Het
Spink12	T	A	18: 44,107,764	C72*	probably null	Het
Spink5	T	A	18: 44,012,975		probably null	Het
Stk40	C	A	4: 126,118,332	S9*	probably null	Het
Sypl	A	T	12: 32,965,421	T40S	probably damaging	Het
Tbc1d8	C	T	1: 39,391,209	E438K	probably benign	Het
Tdrd7	A	G	4: 45,989,102	T111A	probably benign	Het
Tg	A	T	15: 66,741,484		probably null	Het
Tlr5	T	A	1: 182,973,889	W253R	probably damaging	Het
Tmprss11c	C	T	5: 86,235,469	C353Y	probably damaging	Het
Tnfrsf8	T	A	4: 145,288,027	M271L	probably benign	Het
Toe1	T	C	4: 116,806,750	N21S	probably benign	Het
Tpp2	T	C	1: 43,975,447	F649L	probably benign	Het
Ttll1	G	A	15: 83,502,225	Q60*	probably null	Het
Vcp	C	T	4: 42,982,565	R709Q	probably benign	Het
Vmn1r119	T	A	7: 21,011,668	H263L	possibly damaging	Het
Vmn1r195	C	A	13: 22,278,941	Q194K	probably damaging	Het
Vmn1r33	T	C	6: 66,611,799	Y257C	probably damaging	Het
Vmn2r15	A	G	5: 109,293,015	F326L	probably benign	Het
Wbp11	A	T	6: 136,816,110		probably benign	Het
Wwp2	T	G	8: 107,517,946	V250G	probably benign	Het
Xpnpep3	T	C	15: 81,430,837	V246A	probably benign	Het
Zcchc14	G	A	8: 121,605,449	R419*	probably null	Het

Other mutations in Agbl3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00336:Agbl3	APN	6	34846836	missense	probably damaging	1.00
IGL00835:Agbl3	APN	6	34799732	missense	probably damaging	1.00
IGL00840:Agbl3	APN	6	34799159	missense	possibly damaging	0.95
IGL01090:Agbl3	APN	6	34799887	missense	probably benign	0.40
IGL01123:Agbl3	APN	6	34846976	nonsense	probably null
IGL01707:Agbl3	APN	6	34839454	missense	possibly damaging	0.78
IGL01728:Agbl3	APN	6	34782157	start codon destroyed	probably null
IGL02335:Agbl3	APN	6	34799750	missense	probably damaging	1.00
IGL02420:Agbl3	APN	6	34785307	missense	possibly damaging	0.47
IGL02551:Agbl3	APN	6	34823071	missense	possibly damaging	0.88
IGL02974:Agbl3	APN	6	34799822	missense	probably damaging	1.00
IGL03167:Agbl3	APN	6	34857659	missense	possibly damaging	0.92
IGL03182:Agbl3	APN	6	34803500	missense	probably damaging	1.00
R0044:Agbl3	UTSW	6	34799899	missense	probably damaging	1.00
R0499:Agbl3	UTSW	6	34839335	missense	probably benign
R0850:Agbl3	UTSW	6	34799204	missense	probably damaging	1.00
R1004:Agbl3	UTSW	6	34803451	missense	probably damaging	0.99
R1080:Agbl3	UTSW	6	34828235	missense	probably benign	0.14
R1589:Agbl3	UTSW	6	34857517	missense	possibly damaging	0.77
R2361:Agbl3	UTSW	6	34832505	missense	possibly damaging	0.87
R2495:Agbl3	UTSW	6	34846764	missense	probably damaging	1.00
R3236:Agbl3	UTSW	6	34823087	splice site	probably null
R3237:Agbl3	UTSW	6	34823087	splice site	probably null
R3420:Agbl3	UTSW	6	34793965	missense	probably benign	0.36
R3421:Agbl3	UTSW	6	34793965	missense	probably benign	0.36
R3422:Agbl3	UTSW	6	34793965	missense	probably benign	0.36
R3810:Agbl3	UTSW	6	34799729	missense	probably damaging	1.00
R3811:Agbl3	UTSW	6	34799729	missense	probably damaging	1.00
R4059:Agbl3	UTSW	6	34846899	missense	probably damaging	1.00
R4499:Agbl3	UTSW	6	34857598	missense	probably benign	0.00
R4687:Agbl3	UTSW	6	34798326	missense	probably damaging	1.00
R4854:Agbl3	UTSW	6	34785284	missense	probably damaging	0.97
R5354:Agbl3	UTSW	6	34814752	missense	probably benign	0.03
R5386:Agbl3	UTSW	6	34799196	missense	probably damaging	1.00
R5897:Agbl3	UTSW	6	34803573	missense	probably benign	0.21
R6018:Agbl3	UTSW	6	34799255	missense	probably damaging	1.00
R6148:Agbl3	UTSW	6	34857753	missense	possibly damaging	0.87
R6305:Agbl3	UTSW	6	34782210	missense	unknown
R6525:Agbl3	UTSW	6	34803594	nonsense	probably null
R6546:Agbl3	UTSW	6	34799299	missense	probably damaging	1.00
R6743:Agbl3	UTSW	6	34846953	missense	probably benign	0.03
R6986:Agbl3	UTSW	6	34839452	missense	probably benign	0.42
R7023:Agbl3	UTSW	6	34814769	missense	probably benign	0.02
R7411:Agbl3	UTSW	6	34814819	missense	probably damaging	0.99
R7469:Agbl3	UTSW	6	34814414	missense	probably damaging	1.00
R7631:Agbl3	UTSW	6	34857671	missense	possibly damaging	0.95
R7658:Agbl3	UTSW	6	34832508	missense	probably benign	0.11
R7743:Agbl3	UTSW	6	34846830	missense	probably damaging	1.00
R7801:Agbl3	UTSW	6	34839365	missense	probably benign	0.00
R8033:Agbl3	UTSW	6	34839494	missense	possibly damaging	0.95
R8203:Agbl3	UTSW	6	34799479	missense	probably damaging	1.00
R8769:Agbl3	UTSW	6	34857614	missense	probably damaging	0.96
R9072:Agbl3	UTSW	6	34799452	missense	probably damaging	1.00
R9073:Agbl3	UTSW	6	34799452	missense	probably damaging	1.00
R9210:Agbl3	UTSW	6	34798242	missense	probably damaging	0.98
R9255:Agbl3	UTSW	6	34812905	missense	probably damaging	1.00
R9536:Agbl3	UTSW	6	34846926	missense	probably benign
R9560:Agbl3	UTSW	6	34846908	missense	possibly damaging	0.94
R9662:Agbl3	UTSW	6	34832533	nonsense	probably null
RF014:Agbl3	UTSW	6	34799358	missense	possibly damaging	0.53
Z1177:Agbl3	UTSW	6	34799408	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- CAGTTTCCACACAGCCAGGATACG -3'
(R):5'- GGAAAGACTCCTTCAGGAGCGATG -3'

Sequencing Primer
(F):5'- TGTCTGGCATCAACAGTGAC -3'
(R):5'- TGGATTCAGCATGGGTACCA -3'

Posted On

2013-07-11