Incidental Mutation 'R7328:Phldb2'
ID569071
Institutional Source Beutler Lab
Gene Symbol Phldb2
Ensembl Gene ENSMUSG00000033149
Gene Namepleckstrin homology like domain, family B, member 2
SynonymsLL5b, LL5beta, C820004H04Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7328 (G1)
Quality Score225.009
Status Not validated
Chromosome16
Chromosomal Location45746243-45953598 bp(-) (GRCm38)
Type of Mutationcritical splice acceptor site
DNA Base Change (assembly) T to A at 45758209 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000075672 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000036355] [ENSMUST00000076333] [ENSMUST00000076333] [ENSMUST00000076333] [ENSMUST00000134802]
Predicted Effect probably null
Transcript: ENSMUST00000036355
SMART Domains Protein: ENSMUSP00000046496
Gene: ENSMUSG00000033149

DomainStartEndE-ValueType
low complexity region 267 283 N/A INTRINSIC
low complexity region 426 447 N/A INTRINSIC
coiled coil region 580 692 N/A INTRINSIC
coiled coil region 724 800 N/A INTRINSIC
coiled coil region 1027 1097 N/A INTRINSIC
PH 1140 1244 6.45e-17 SMART
Predicted Effect probably null
Transcript: ENSMUST00000076333
SMART Domains Protein: ENSMUSP00000075672
Gene: ENSMUSG00000033149

DomainStartEndE-ValueType
low complexity region 267 283 N/A INTRINSIC
low complexity region 426 447 N/A INTRINSIC
coiled coil region 580 692 N/A INTRINSIC
coiled coil region 724 800 N/A INTRINSIC
low complexity region 901 913 N/A INTRINSIC
coiled coil region 1080 1150 N/A INTRINSIC
PH 1193 1297 6.45e-17 SMART
Predicted Effect probably null
Transcript: ENSMUST00000076333
SMART Domains Protein: ENSMUSP00000075672
Gene: ENSMUSG00000033149

DomainStartEndE-ValueType
low complexity region 267 283 N/A INTRINSIC
low complexity region 426 447 N/A INTRINSIC
coiled coil region 580 692 N/A INTRINSIC
coiled coil region 724 800 N/A INTRINSIC
low complexity region 901 913 N/A INTRINSIC
coiled coil region 1080 1150 N/A INTRINSIC
PH 1193 1297 6.45e-17 SMART
Predicted Effect probably null
Transcript: ENSMUST00000076333
SMART Domains Protein: ENSMUSP00000075672
Gene: ENSMUSG00000033149

DomainStartEndE-ValueType
low complexity region 267 283 N/A INTRINSIC
low complexity region 426 447 N/A INTRINSIC
coiled coil region 580 692 N/A INTRINSIC
coiled coil region 724 800 N/A INTRINSIC
low complexity region 901 913 N/A INTRINSIC
coiled coil region 1080 1150 N/A INTRINSIC
PH 1193 1297 6.45e-17 SMART
Predicted Effect probably null
Transcript: ENSMUST00000131003
SMART Domains Protein: ENSMUSP00000119718
Gene: ENSMUSG00000033149

DomainStartEndE-ValueType
coiled coil region 1 55 N/A INTRINSIC
coiled coil region 87 163 N/A INTRINSIC
coiled coil region 342 412 N/A INTRINSIC
PH 456 560 6.45e-17 SMART
Predicted Effect probably null
Transcript: ENSMUST00000134802
SMART Domains Protein: ENSMUSP00000123284
Gene: ENSMUSG00000033149

DomainStartEndE-ValueType
low complexity region 20 28 N/A INTRINSIC
low complexity region 312 328 N/A INTRINSIC
low complexity region 471 492 N/A INTRINSIC
coiled coil region 625 737 N/A INTRINSIC
coiled coil region 769 845 N/A INTRINSIC
coiled coil region 1072 1131 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933427D14Rik C G 11: 72,169,780 probably null Het
Abca13 T A 11: 9,291,545 V1136E probably benign Het
Arl4c C A 1: 88,701,517 E50* probably null Het
Atxn7l1 T C 12: 33,148,503 probably null Het
Ctdsp1 A T 1: 74,394,040 I115F probably damaging Het
Cyp2j5 A G 4: 96,663,213 V91A probably damaging Het
Dscam T A 16: 96,645,035 K1469* probably null Het
Elf2 A G 3: 51,266,777 C110R probably damaging Het
Ephb1 A G 9: 102,195,239 Y114H probably damaging Het
Ephb2 C T 4: 136,658,934 probably null Het
Fbxw20 C A 9: 109,232,315 C122F probably damaging Het
Flnb T C 14: 7,883,788 I338T possibly damaging Het
Flnb T A 14: 7,894,660 Y819* probably null Het
Foxo3 A T 10: 42,197,262 S420T probably benign Het
Herpud1 T C 8: 94,386,620 V10A possibly damaging Het
Hmcn1 A T 1: 150,638,866 V3585E possibly damaging Het
Hsdl1 T C 8: 119,566,091 T202A probably benign Het
Htr1d G A 4: 136,443,303 S281N probably benign Het
Igkv14-111 T A 6: 68,256,725 I70N probably damaging Het
Igkv8-34 A G 6: 70,044,344 S45P probably damaging Het
Inha T C 1: 75,510,116 Y352H probably damaging Het
Lats1 A T 10: 7,705,547 M699L possibly damaging Het
March9 T C 10: 127,058,296 E146G probably damaging Het
Mcm8 T C 2: 132,832,857 V443A probably benign Het
Melk A T 4: 44,332,931 S296C probably benign Het
Myo18a T C 11: 77,807,911 S4P Het
Myof T C 19: 37,916,399 Y1646C probably damaging Het
Noc4l C A 5: 110,648,923 A498S possibly damaging Het
Nrxn3 T C 12: 88,795,575 S131P probably benign Het
Olfr1052 GTACTTTTT GT 2: 86,297,994 probably null Het
Olfr291 T C 7: 84,857,299 I312T probably benign Het
Olfr937 T C 9: 39,060,561 Y35C probably damaging Het
Olfr993 A G 2: 85,414,324 I185T probably benign Het
Pcp4l1 G A 1: 171,174,465 A42V possibly damaging Het
Polr2b C T 5: 77,315,999 P81L probably damaging Het
Rbfa C A 18: 80,193,239 G215C probably benign Het
Rdh19 T C 10: 127,857,027 S188P probably damaging Het
Scn9a T C 2: 66,484,587 M1596V probably benign Het
Sele A T 1: 164,049,275 Y40F probably benign Het
Setd1b T A 5: 123,152,379 V803D unknown Het
Siglecf C T 7: 43,352,267 T167I possibly damaging Het
Slc39a6 T C 18: 24,600,930 E234G probably benign Het
Slco1a1 T A 6: 141,936,408 D145V possibly damaging Het
Son G A 16: 91,658,390 V1342I probably benign Het
Sybu G A 15: 44,787,794 P38L not run Het
Taf15 C T 11: 83,484,832 T41M possibly damaging Het
Tm4sf4 A T 3: 57,426,504 N71Y probably benign Het
Tm7sf2 C T 19: 6,064,126 V226I possibly damaging Het
Trim66 C A 7: 109,457,751 Q1066H probably damaging Het
Tyw1 T C 5: 130,262,844 V51A probably benign Het
Vav3 A T 3: 109,503,428 I192L probably benign Het
Other mutations in Phldb2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00321:Phldb2 APN 16 45772254 missense probably damaging 1.00
IGL00485:Phldb2 APN 16 45757188 missense possibly damaging 0.75
IGL00544:Phldb2 APN 16 45825311 missense probably damaging 1.00
IGL00547:Phldb2 APN 16 45825535 missense probably benign 0.00
IGL00835:Phldb2 APN 16 45751456 missense probably damaging 1.00
IGL00987:Phldb2 APN 16 45763102 missense possibly damaging 0.78
IGL01102:Phldb2 APN 16 45825060 missense probably damaging 1.00
IGL01530:Phldb2 APN 16 45802729 missense probably damaging 1.00
IGL01549:Phldb2 APN 16 45774318 missense probably benign 0.00
IGL01712:Phldb2 APN 16 45751429 missense probably damaging 1.00
IGL01755:Phldb2 APN 16 45825582 missense probably damaging 0.96
IGL01823:Phldb2 APN 16 45825144 missense probably damaging 0.97
IGL02353:Phldb2 APN 16 45748779 missense probably damaging 1.00
IGL02360:Phldb2 APN 16 45748779 missense probably damaging 1.00
IGL02716:Phldb2 APN 16 45801590 missense probably damaging 0.99
R0139:Phldb2 UTSW 16 45770666 splice site probably benign
R0312:Phldb2 UTSW 16 45789047 missense probably damaging 1.00
R0379:Phldb2 UTSW 16 45781451 missense probably damaging 1.00
R0535:Phldb2 UTSW 16 45757127 missense probably damaging 1.00
R1387:Phldb2 UTSW 16 45825994 missense possibly damaging 0.69
R1444:Phldb2 UTSW 16 45757253 splice site probably benign
R1487:Phldb2 UTSW 16 45789024 missense probably damaging 1.00
R1501:Phldb2 UTSW 16 45777783 missense probably damaging 1.00
R1605:Phldb2 UTSW 16 45770779 splice site probably benign
R1716:Phldb2 UTSW 16 45775050 missense probably benign 0.01
R1732:Phldb2 UTSW 16 45757166 missense probably damaging 1.00
R1779:Phldb2 UTSW 16 45801625 missense probably damaging 1.00
R1824:Phldb2 UTSW 16 45826011 missense probably benign 0.14
R2001:Phldb2 UTSW 16 45774195 missense possibly damaging 0.66
R2066:Phldb2 UTSW 16 45770758 missense probably damaging 1.00
R2122:Phldb2 UTSW 16 45762941 missense probably damaging 0.99
R2448:Phldb2 UTSW 16 45825363 missense probably damaging 1.00
R2932:Phldb2 UTSW 16 45748785 missense possibly damaging 0.85
R3076:Phldb2 UTSW 16 45825010 missense probably benign 0.00
R3078:Phldb2 UTSW 16 45825010 missense probably benign 0.00
R3779:Phldb2 UTSW 16 45748755 missense probably damaging 1.00
R3914:Phldb2 UTSW 16 45757163 missense probably damaging 1.00
R4536:Phldb2 UTSW 16 45770681 missense probably benign 0.04
R4568:Phldb2 UTSW 16 45777718 nonsense probably null
R4798:Phldb2 UTSW 16 45825874 missense probably damaging 1.00
R4853:Phldb2 UTSW 16 45802716 missense probably damaging 0.99
R4906:Phldb2 UTSW 16 45751395 missense probably damaging 1.00
R4984:Phldb2 UTSW 16 45825633 missense probably damaging 1.00
R5078:Phldb2 UTSW 16 45777742 missense possibly damaging 0.85
R5137:Phldb2 UTSW 16 45808258 missense possibly damaging 0.85
R5237:Phldb2 UTSW 16 45747886 missense probably damaging 0.99
R5410:Phldb2 UTSW 16 45825612 missense possibly damaging 0.77
R5825:Phldb2 UTSW 16 45763097 missense probably benign 0.11
R5874:Phldb2 UTSW 16 45801625 missense probably damaging 1.00
R5907:Phldb2 UTSW 16 45825188 missense probably damaging 1.00
R6332:Phldb2 UTSW 16 45774246 missense probably benign
R6354:Phldb2 UTSW 16 45825114 missense probably damaging 1.00
R6355:Phldb2 UTSW 16 45825338 missense probably damaging 0.99
R6383:Phldb2 UTSW 16 45748750 missense probably damaging 1.00
R6463:Phldb2 UTSW 16 45774993 missense probably benign 0.37
R6513:Phldb2 UTSW 16 45747877 missense possibly damaging 0.96
R6593:Phldb2 UTSW 16 45825427 nonsense probably null
R6756:Phldb2 UTSW 16 45808320 missense probably benign 0.02
R6810:Phldb2 UTSW 16 45748725 critical splice donor site probably null
R6897:Phldb2 UTSW 16 45777775 missense probably damaging 1.00
R7010:Phldb2 UTSW 16 45751505 missense probably damaging 0.99
R7142:Phldb2 UTSW 16 45757176 nonsense probably null
R7149:Phldb2 UTSW 16 45751532 nonsense probably null
R7249:Phldb2 UTSW 16 45801614 missense probably damaging 1.00
R7300:Phldb2 UTSW 16 45825562 missense probably damaging 1.00
R7515:Phldb2 UTSW 16 45774240 missense possibly damaging 0.90
R7840:Phldb2 UTSW 16 45751364 missense probably damaging 1.00
R7988:Phldb2 UTSW 16 45825571 missense probably benign 0.03
R8159:Phldb2 UTSW 16 45860384 missense possibly damaging 0.82
R8353:Phldb2 UTSW 16 45825022 missense probably benign 0.00
R8453:Phldb2 UTSW 16 45825022 missense probably benign 0.00
RF008:Phldb2 UTSW 16 45762974 missense probably damaging 1.00
Z1176:Phldb2 UTSW 16 45825826 missense probably benign 0.43
Z1176:Phldb2 UTSW 16 45825827 missense probably benign 0.04
Z1176:Phldb2 UTSW 16 45953508 unclassified probably benign
Z1190:Phldb2 UTSW 16 45825334 missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- GGGCGCCAATTCTTTAGCAC -3'
(R):5'- TTAGAGATGAGTTGATTAGCCCC -3'

Sequencing Primer
(F):5'- TGAGCAGCTCCCAAGGTCAC -3'
(R):5'- TGAGTTGATTAGCCCCCAAAAG -3'
Posted On2019-09-13