Incidental Mutation 'R7329:Trdmt1'
ID569083
Institutional Source Beutler Lab
Gene Symbol Trdmt1
Ensembl Gene ENSMUSG00000026723
Gene NametRNA aspartic acid methyltransferase 1
SynonymsRnmt2, Dnmt2
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.411) question?
Stock #R7329 (G1)
Quality Score225.009
Status Validated
Chromosome2
Chromosomal Location13509014-13544668 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 13516122 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 323 (L323P)
Ref Sequence ENSEMBL: ENSMUSP00000114572 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000124488]
Predicted Effect probably damaging
Transcript: ENSMUST00000124488
AA Change: L323P

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000114572
Gene: ENSMUSG00000026723
AA Change: L323P

DomainStartEndE-ValueType
Pfam:DNA_methylase 4 391 1.6e-45 PFAM
Meta Mutation Damage Score 0.6403 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.4%
Validation Efficiency 100% (78/78)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein responsible for the methylation of aspartic acid transfer RNA, specifically at the cytosine-38 residue in the anticodon loop. This enzyme also possesses residual DNA-(cytosine-C5) methyltransferase activity. While similar in sequence and structure to DNA cytosine methyltransferases, this gene is distinct and highly conserved in its function among taxa. [provided by RefSeq, Jun 2010]
PHENOTYPE: Mice homozygous for disruptions in this gene have a decreased proportion of natural killer cells in the peripheral blood. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 79 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700019N19Rik T C 19: 58,789,222 E52G probably damaging Het
Actb T C 5: 142,904,391 N252S probably benign Het
Adgrb1 C A 15: 74,539,245 T330K probably damaging Het
Ahnak A G 19: 9,001,792 T147A probably damaging Het
Ankfy1 T C 11: 72,712,208 V21A probably damaging Het
Arrdc4 T A 7: 68,741,027 N322Y probably damaging Het
Bfsp2 C A 9: 103,449,922 E205D probably benign Het
C2cd4b T A 9: 67,760,137 S138R possibly damaging Het
Camkk1 C G 11: 73,027,047 N147K probably damaging Het
Ckap2l T A 2: 129,285,364 Q298L possibly damaging Het
Clstn2 G T 9: 97,461,369 A675D probably benign Het
Cntnap2 G A 6: 47,271,271 V1204M possibly damaging Het
Col4a1 C T 8: 11,226,494 probably null Het
Ctrc T C 4: 141,843,711 T73A probably benign Het
Cubn A G 2: 13,468,771 F454L probably damaging Het
Cuedc1 A T 11: 88,169,866 S12C unknown Het
Cyb561a3 G T 19: 10,587,904 G211C probably damaging Het
D5Ertd579e A T 5: 36,616,395 S219T probably benign Het
Dennd4c C T 4: 86,779,874 P200S possibly damaging Het
Dennd4c T A 4: 86,841,081 Y1783N probably damaging Het
Dnah6 G A 6: 73,144,722 Q1426* probably null Het
Dync2h1 T G 9: 7,011,247 T3649P probably benign Het
E2f8 T C 7: 48,872,110 S415G probably damaging Het
Fbxo22 A G 9: 55,214,977 I147V probably benign Het
Gclc A G 9: 77,776,191 Y110C probably damaging Het
Gm15922 G A 7: 3,739,876 probably benign Het
Gstm5 A G 3: 107,896,331 T27A possibly damaging Het
Heatr4 A G 12: 83,978,082 S322P probably benign Het
Htt T A 5: 34,829,755 I1106N probably benign Het
Hunk T C 16: 90,386,682 V76A probably benign Het
Igkv12-98 C T 6: 68,571,103 T72I possibly damaging Het
Igkv9-123 A T 6: 67,954,645 W16R possibly damaging Het
Ipo7 T C 7: 110,049,017 L674S possibly damaging Het
Kcnh6 T C 11: 106,017,377 F273S probably benign Het
Lamb3 C A 1: 193,320,540 Q98K possibly damaging Het
Lingo4 A T 3: 94,402,855 T367S probably benign Het
Lypd6b A T 2: 49,942,500 I26F probably benign Het
Maneal T C 4: 124,856,719 T415A probably benign Het
Mapk1ip1l A G 14: 47,310,463 T23A unknown Het
Mrps17 T A 5: 129,716,641 probably benign Het
Mup13 T G 4: 61,227,689 D45A probably damaging Het
Mycbpap T A 11: 94,509,247 D408V probably damaging Het
Myh10 A G 11: 68,810,191 H1742R probably benign Het
Mylk4 A G 13: 32,716,783 Y255H probably damaging Het
Nbeal1 A G 1: 60,217,196 Q200R probably benign Het
Nkain2 TTTACTCGTT TTT 10: 32,889,896 probably null Het
Olfm4 T C 14: 80,011,929 V162A possibly damaging Het
Olfr1151 T C 2: 87,857,241 V22A probably benign Het
Olfr251 C A 9: 38,378,160 T87K probably benign Het
Olfr344 A G 2: 36,568,696 T33A probably benign Het
Olfr570 T C 7: 102,900,832 L155P probably damaging Het
Ovol3 T A 7: 30,235,252 R43S probably benign Het
Pcbp1 A G 6: 86,525,116 V267A probably benign Het
Phf20 T A 2: 156,304,632 V903E probably damaging Het
Pi4k2b T G 5: 52,756,869 S316A probably benign Het
Pkhd1 A T 1: 20,547,519 H947Q probably damaging Het
Ppip5k2 A C 1: 97,750,753 probably null Het
Prkca T A 11: 108,014,277 T212S possibly damaging Het
Psg16 A T 7: 17,090,686 I41F possibly damaging Het
Rae1 T A 2: 173,009,445 F204I probably benign Het
Rasef T A 4: 73,744,137 N192I probably damaging Het
Rfc1 T A 5: 65,263,135 R1122S unknown Het
Rfx2 A T 17: 56,803,681 S102T probably benign Het
Sez6l A G 5: 112,440,907 Y647H probably damaging Het
Siglecf A G 7: 43,351,971 Y121C probably damaging Het
Slc27a5 T C 7: 12,991,162 T453A possibly damaging Het
Slc44a2 G A 9: 21,342,752 R171Q probably damaging Het
Slc4a9 A C 18: 36,540,821 E889A possibly damaging Het
Snx31 C A 15: 36,555,476 R13L probably benign Het
Spag6l A T 16: 16,767,019 Y422N probably benign Het
Sulf2 T C 2: 166,117,088 T67A probably damaging Het
Syne2 G A 12: 75,966,984 R2983Q probably benign Het
Tmtc3 A G 10: 100,447,419 I758T probably benign Het
Top2a T A 11: 99,004,246 I843L possibly damaging Het
Tph1 T C 7: 46,656,861 probably null Het
Ush2a A T 1: 188,553,198 E1977V probably damaging Het
Utp4 A G 8: 106,913,463 E468G probably benign Het
Uts2r A G 11: 121,160,732 T141A possibly damaging Het
Vmn1r230 A G 17: 20,846,690 Y47C probably damaging Het
Other mutations in Trdmt1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01135:Trdmt1 APN 2 13521260 splice site probably null
IGL01584:Trdmt1 APN 2 13519928 missense probably benign 0.00
IGL02491:Trdmt1 APN 2 13516672 missense probably benign 0.17
IGL03025:Trdmt1 APN 2 13523435 missense probably damaging 0.98
R0167:Trdmt1 UTSW 2 13516018 missense probably damaging 1.00
R0193:Trdmt1 UTSW 2 13544617 missense probably damaging 1.00
R0638:Trdmt1 UTSW 2 13516648 splice site probably benign
R0690:Trdmt1 UTSW 2 13544580 missense probably benign 0.01
R0735:Trdmt1 UTSW 2 13523438 missense probably benign 0.23
R1102:Trdmt1 UTSW 2 13523414 splice site probably benign
R1432:Trdmt1 UTSW 2 13519846 missense probably damaging 0.98
R1610:Trdmt1 UTSW 2 13516059 missense probably damaging 1.00
R1935:Trdmt1 UTSW 2 13511609 missense probably damaging 1.00
R1936:Trdmt1 UTSW 2 13511609 missense probably damaging 1.00
R2060:Trdmt1 UTSW 2 13519914 missense probably benign 0.01
R2231:Trdmt1 UTSW 2 13525625 missense probably damaging 1.00
R2339:Trdmt1 UTSW 2 13520060 nonsense probably null
R3703:Trdmt1 UTSW 2 13521297 missense probably benign 0.16
R3735:Trdmt1 UTSW 2 13519873 missense possibly damaging 0.51
R4751:Trdmt1 UTSW 2 13544653 utr 5 prime probably benign
R6258:Trdmt1 UTSW 2 13520059 missense probably benign 0.01
R6260:Trdmt1 UTSW 2 13520059 missense probably benign 0.01
R6799:Trdmt1 UTSW 2 13516013 critical splice donor site probably null
R8126:Trdmt1 UTSW 2 13520005 missense probably benign 0.39
Predicted Primers PCR Primer
(F):5'- AGGGCAGCAGGGATTCATTC -3'
(R):5'- CTGGTGTCATTATCCAGCCAATTATAC -3'

Sequencing Primer
(F):5'- TCATACAATGCCCGTGTGAG -3'
(R):5'- CCAGCCAATTATACAATTGTTGCAC -3'
Posted On2019-09-13