Incidental Mutation 'R7329:Gstm5'
ID569092
Institutional Source Beutler Lab
Gene Symbol Gstm5
Ensembl Gene ENSMUSG00000004032
Gene Nameglutathione S-transferase, mu 5
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7329 (G1)
Quality Score225.009
Status Validated
Chromosome3
Chromosomal Location107895821-107898686 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 107896331 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 27 (T27A)
Ref Sequence ENSEMBL: ENSMUSP00000004134 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000004134] [ENSMUST00000037375] [ENSMUST00000167387] [ENSMUST00000167523] [ENSMUST00000169365] [ENSMUST00000170058] [ENSMUST00000172247]
Predicted Effect possibly damaging
Transcript: ENSMUST00000004134
AA Change: T27A

PolyPhen 2 Score 0.685 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000004134
Gene: ENSMUSG00000004032
AA Change: T27A

DomainStartEndE-ValueType
Pfam:GST_N 6 85 4e-23 PFAM
Pfam:GST_C 107 195 1.5e-19 PFAM
Pfam:GST_C_3 113 193 2.9e-8 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000037375
SMART Domains Protein: ENSMUSP00000042004
Gene: ENSMUSG00000040600

DomainStartEndE-ValueType
Pfam:PTB 28 155 3.7e-40 PFAM
low complexity region 204 214 N/A INTRINSIC
low complexity region 230 247 N/A INTRINSIC
low complexity region 273 285 N/A INTRINSIC
SH3 460 515 5.19e-15 SMART
PDB:2E8M|A 516 582 3e-7 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000167387
SMART Domains Protein: ENSMUSP00000127020
Gene: ENSMUSG00000004032

DomainStartEndE-ValueType
Pfam:GST_C 41 129 2.1e-19 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000167523
AA Change: T27A

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000127840
Gene: ENSMUSG00000004032
AA Change: T27A

DomainStartEndE-ValueType
Pfam:GST_N 6 67 6.2e-11 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000169365
SMART Domains Protein: ENSMUSP00000128306
Gene: ENSMUSG00000004032

DomainStartEndE-ValueType
Pfam:GST_C 41 129 2.1e-19 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000170058
AA Change: T27A
SMART Domains Protein: ENSMUSP00000125913
Gene: ENSMUSG00000004032
AA Change: T27A

DomainStartEndE-ValueType
Pfam:GST_N 6 55 3.4e-9 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000172247
AA Change: T27A

PolyPhen 2 Score 0.042 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000129426
Gene: ENSMUSG00000004032
AA Change: T27A

DomainStartEndE-ValueType
Pfam:GST_N 6 85 2.1e-21 PFAM
Pfam:GST_C 107 193 2.2e-18 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.4%
Validation Efficiency 100% (78/78)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Cytosolic and membrane-bound forms of glutathione S-transferase are encoded by two distinct supergene families. At present, eight distinct classes of the soluble cytoplasmic mammalian glutathione S-transferases have been identified: alpha, kappa, mu, omega, pi, sigma, theta and zeta. This gene encodes a glutathione S-transferase that belongs to the mu class. The mu class of enzymes functions in the detoxification of electrophilic compounds, including carcinogens, therapeutic drugs, environmental toxins and products of oxidative stress, by conjugation with glutathione. The genes encoding the mu class of enzymes are organized in a gene cluster on chromosome 1p13.3 and are known to be highly polymorphic. These genetic variations can change an individual's susceptibility to carcinogens and toxins as well as affect the toxicity and efficacy of certain drugs. Mutations of this class mu gene have been linked with a slight increase in a number of cancers, likely due to exposure with environmental toxins. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Nov 2008]
Allele List at MGI
Other mutations in this stock
Total: 79 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700019N19Rik T C 19: 58,789,222 E52G probably damaging Het
Actb T C 5: 142,904,391 N252S probably benign Het
Adgrb1 C A 15: 74,539,245 T330K probably damaging Het
Ahnak A G 19: 9,001,792 T147A probably damaging Het
Ankfy1 T C 11: 72,712,208 V21A probably damaging Het
Arrdc4 T A 7: 68,741,027 N322Y probably damaging Het
Bfsp2 C A 9: 103,449,922 E205D probably benign Het
C2cd4b T A 9: 67,760,137 S138R possibly damaging Het
Camkk1 C G 11: 73,027,047 N147K probably damaging Het
Ckap2l T A 2: 129,285,364 Q298L possibly damaging Het
Clstn2 G T 9: 97,461,369 A675D probably benign Het
Cntnap2 G A 6: 47,271,271 V1204M possibly damaging Het
Col4a1 C T 8: 11,226,494 probably null Het
Ctrc T C 4: 141,843,711 T73A probably benign Het
Cubn A G 2: 13,468,771 F454L probably damaging Het
Cuedc1 A T 11: 88,169,866 S12C unknown Het
Cyb561a3 G T 19: 10,587,904 G211C probably damaging Het
D5Ertd579e A T 5: 36,616,395 S219T probably benign Het
Dennd4c C T 4: 86,779,874 P200S possibly damaging Het
Dennd4c T A 4: 86,841,081 Y1783N probably damaging Het
Dnah6 G A 6: 73,144,722 Q1426* probably null Het
Dync2h1 T G 9: 7,011,247 T3649P probably benign Het
E2f8 T C 7: 48,872,110 S415G probably damaging Het
Fbxo22 A G 9: 55,214,977 I147V probably benign Het
Gclc A G 9: 77,776,191 Y110C probably damaging Het
Gm15922 G A 7: 3,739,876 probably benign Het
Heatr4 A G 12: 83,978,082 S322P probably benign Het
Htt T A 5: 34,829,755 I1106N probably benign Het
Hunk T C 16: 90,386,682 V76A probably benign Het
Igkv12-98 C T 6: 68,571,103 T72I possibly damaging Het
Igkv9-123 A T 6: 67,954,645 W16R possibly damaging Het
Ipo7 T C 7: 110,049,017 L674S possibly damaging Het
Kcnh6 T C 11: 106,017,377 F273S probably benign Het
Lamb3 C A 1: 193,320,540 Q98K possibly damaging Het
Lingo4 A T 3: 94,402,855 T367S probably benign Het
Lypd6b A T 2: 49,942,500 I26F probably benign Het
Maneal T C 4: 124,856,719 T415A probably benign Het
Mapk1ip1l A G 14: 47,310,463 T23A unknown Het
Mrps17 T A 5: 129,716,641 probably benign Het
Mup13 T G 4: 61,227,689 D45A probably damaging Het
Mycbpap T A 11: 94,509,247 D408V probably damaging Het
Myh10 A G 11: 68,810,191 H1742R probably benign Het
Mylk4 A G 13: 32,716,783 Y255H probably damaging Het
Nbeal1 A G 1: 60,217,196 Q200R probably benign Het
Nkain2 TTTACTCGTT TTT 10: 32,889,896 probably null Het
Olfm4 T C 14: 80,011,929 V162A possibly damaging Het
Olfr1151 T C 2: 87,857,241 V22A probably benign Het
Olfr251 C A 9: 38,378,160 T87K probably benign Het
Olfr344 A G 2: 36,568,696 T33A probably benign Het
Olfr570 T C 7: 102,900,832 L155P probably damaging Het
Ovol3 T A 7: 30,235,252 R43S probably benign Het
Pcbp1 A G 6: 86,525,116 V267A probably benign Het
Phf20 T A 2: 156,304,632 V903E probably damaging Het
Pi4k2b T G 5: 52,756,869 S316A probably benign Het
Pkhd1 A T 1: 20,547,519 H947Q probably damaging Het
Ppip5k2 A C 1: 97,750,753 probably null Het
Prkca T A 11: 108,014,277 T212S possibly damaging Het
Psg16 A T 7: 17,090,686 I41F possibly damaging Het
Rae1 T A 2: 173,009,445 F204I probably benign Het
Rasef T A 4: 73,744,137 N192I probably damaging Het
Rfc1 T A 5: 65,263,135 R1122S unknown Het
Rfx2 A T 17: 56,803,681 S102T probably benign Het
Sez6l A G 5: 112,440,907 Y647H probably damaging Het
Siglecf A G 7: 43,351,971 Y121C probably damaging Het
Slc27a5 T C 7: 12,991,162 T453A possibly damaging Het
Slc44a2 G A 9: 21,342,752 R171Q probably damaging Het
Slc4a9 A C 18: 36,540,821 E889A possibly damaging Het
Snx31 C A 15: 36,555,476 R13L probably benign Het
Spag6l A T 16: 16,767,019 Y422N probably benign Het
Sulf2 T C 2: 166,117,088 T67A probably damaging Het
Syne2 G A 12: 75,966,984 R2983Q probably benign Het
Tmtc3 A G 10: 100,447,419 I758T probably benign Het
Top2a T A 11: 99,004,246 I843L possibly damaging Het
Tph1 T C 7: 46,656,861 probably null Het
Trdmt1 A G 2: 13,516,122 L323P probably damaging Het
Ush2a A T 1: 188,553,198 E1977V probably damaging Het
Utp4 A G 8: 106,913,463 E468G probably benign Het
Uts2r A G 11: 121,160,732 T141A possibly damaging Het
Vmn1r230 A G 17: 20,846,690 Y47C probably damaging Het
Other mutations in Gstm5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00838:Gstm5 APN 3 107897558 missense probably benign 0.11
IGL02219:Gstm5 APN 3 107898031 missense probably damaging 1.00
R0685:Gstm5 UTSW 3 107897319 missense probably damaging 1.00
R2364:Gstm5 UTSW 3 107896371 missense probably benign 0.00
R3836:Gstm5 UTSW 3 107896362 missense probably benign 0.00
R4600:Gstm5 UTSW 3 107897986 missense probably damaging 1.00
R5097:Gstm5 UTSW 3 107895942 start gained probably benign
R5369:Gstm5 UTSW 3 107898466 missense probably damaging 1.00
R5415:Gstm5 UTSW 3 107897495 missense probably damaging 1.00
R5689:Gstm5 UTSW 3 107896665 missense probably damaging 0.97
R5832:Gstm5 UTSW 3 107897537 missense probably benign 0.01
R5988:Gstm5 UTSW 3 107895954 start codon destroyed probably benign
R7546:Gstm5 UTSW 3 107897294 missense probably damaging 1.00
X0020:Gstm5 UTSW 3 107895966 missense probably benign 0.27
Predicted Primers PCR Primer
(F):5'- TAAGGTACTGGAAGTTCCCGG -3'
(R):5'- TGCAAAGATGGGCCTGAAC -3'

Sequencing Primer
(F):5'- AAGTTCCCGGGCGTGAG -3'
(R):5'- GGCCTGAACAGCAAGAGATAACTC -3'
Posted On2019-09-13